| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUCGCGCGACGACCGCGGGGUCGGCGGGCGGGGCGAGGCCCUGGACGG… | 4259 nt | 0.4717 |
This gene, a member of the SNAP25 gene family, encodes a protein involved in multiple membrane trafficking steps. Two other members of this gene family, SNAP23 and SNAP25, encode proteins that bind a syntaxin protein and mediate synaptic vesicle membrane docking and fusion to the plasma membrane. The protein encoded by this gene binds tightly to multiple syntaxins and is localized to intracellular membrane structures rather than to the plasma membrane. While the protein is mostly membrane-bound, a significant fraction of it is found free in the cytoplasm. Use of multiple polyadenylation sites has been noted for this gene. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the SNAP29 in microglia, where it is involved in the autophagy pathway [Oladapo et al. DOI:10.3390/Ijms26020649].