Basic Information

Symbol
SNAP29
RNA class
mRNA
Alias
Synaptosome Associated Protein 29 SNAP-29 Soluble 29 KDa NSF Attachment Protein CEDNIK Cerebral Dysgenesis, Neuropathy, Ichthyosis And Keratoderma Syndrome Vesicle-Membrane Fusion Protein SNAP-29 Synaptosomal-Associated Protein, 29kDa Synaptosomal-Associated Protein 29 Synaptosomal-Associated Protein, 29kD Synaptosome Associated Protein 29kDa
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_004782.4
Sequence length
4259.0 nt
GC content
0.4717

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1353.10 kcal/mol
Thermodynamic ensemble
Free energy: -1426.97 kcal/mol
Frequency: 0.0000
Diversity: 840.78
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((..(((((....)))))(((((((.(.((.((((((((((((.((.(.(.(((.(((((.((..((((.....))))..))))))).))).).).)).(((.(((((.......))))))))..))))))).......((((((((.(...(((((((..(((......))).))).))))...).))))))))..))))))).).)))))))((...(((..((((.(((((((.(((....))))))))))))))..)))....))(((((.(((....)))..)))))(((((....(((.(((((.....))))).)))..((((((((((.(((((((((((((.(((((((.(((((((((((((.(((((.(((((.((.((.((((((.((((((((((((((((..((((((.((...........))..))))))....))))))))......))))))))..........(((((....((.(((.((...((((..(((.(((.((((((.......(((..(((((((((((............((((((((((((........((((((..((((((.............((((.(((((....(((((....))).))((((((((((....((((((....)))))).....))))))..........)))))))))))))......((((((...........))))))..(((((...((((((.(((.(((((.((((((((((..((.....(((.((((.(((.....(((((((((((.(((.((.........))))).))))...)))))))........(((((((((((..(((((((.....((((....)))))))))))(((((((((((((((((((((((((...)))))))))).((((.(((...)))..))))..(((((...)))))(((((((........)))))))...))))))))))))).))(((((.((((.......)))).)))))..(((((...(((...........)))..)))))((((((......(((((((((((((((((..(((.....(((..(.((.(((....))))).).)))..))))))))))))........))))))))...((((.(((((((..(((((....)))))..(((((...((((((((((((...((((((((((((((.((((((.......(((((..............)))))..(((((.....((((((.((((.(((((....)))))(((((((((((((((((((((.....((((((((((..............................................((((((((.....(.((((..(..((((((((((.........))))))))))..)....))))).....))))))))..............((((((..((.(((((((((......(((((..........))).))......))).)).)))).))...))))))..((.....))))))))))))...)))))))))...))).....))))))))).)))).)))))).......)))))..((((((........))))))........)))))).))))))))))))))......(((...)))...(((((..(((((((((.....(((((....)))))((((..((((((.(((((..........)))))..))))))..))))((((.....))))...........((((.((...(((((....))))))))))))))))))))..)))))))))..(((((((((((((.....(..((((...((((.....(((((((((....))))..)))))....))))))))..)..)))))))).)))))...((((((....((((.....))))((((((((((......(((.((((.(((((((.((((((((((((.((((((....((((....))))..............((((((.((((((.....))))))))))))..((.(((....)))))...))))))))))).............)))))..)).)))))))))))........((((..(.(((((((.........(((((((................)))))))......))))))).)..))))...(((.(((.........))))))..))).......))))))))))...))))))(((....)))((((((((((((.....((....)).....)))))).)))))).........))))))))))))))))))..))))))...............((((....))))..))))))))))))))))).....))).)))).)))..))..)))))))).)).)).)))...)))...)))))).)))))))))).)..)))))).....((((((((....(((((....)))))...)))))))).(((.........(((((........).))))(((......................)))...............((((((((((..(((.(((((((((((....((((.........)))).))))))))))).)))(((((.......)))))...((((...((......))...))))..(((((((((((((..................))))))....)))))))(((((((....(((((........)))))..((((((...)))))).((((...(((....)))))))...((((((((.......(((..((((((((..(((.(((((.....))))).)))......))))))))....)))........)))...))))))))))))))))))..))))..))))))).))))))))))))))))))).)))........)))...))).))).))).))))....)).))).))......))))).((((((((....(.(((((........))))).)...)).))))))...((((((....((((((((((..(((.....)))...))).))))))))))))).)))))).)).)))))))))))).............(((((....)))))...))).)))..........(((..((.(((.(((((((...)))))))))).))..)))......)))))))..))))))).).)))))..(((..((((.........((((((..((((.((((((((((((.((((((.(..((....((.((((.((((((((((((((((((((.((((((((..........))))))))...)))))))))).)))((....)).((((((((((((.....)))........((((((.((.......)).))))))..(((((((..........))))))).)))))))))(((((.((((.....((((((((((((((....))))))))((((..((((..((((((((...........))))))))......))))..)))).(((((....................(((((((((..((((.....))))....).))))))))(((((....)))))...)))))...........)))))))))))))))(((((((.(((......).)))))))))..))))))).)))).))..))..).))))))......................)))).))).....)))))))))....))))))...((((((...........((((((....))))))))))))((((....))))......))))..)))(((((.......))).))....(((((((.(((((............))))).))).)))).))))))).)))(((((....))))).))))))).)))))((......))))))))))....((((((((((((((..((.((....))..))..))))).)))))))))..............(((((((((.(.....((((....)))).(((((((.(((...(((((((.......))))))).)))))))))).(((((((((.((((.((.((((.........))))..)))))).))))))))).......).)))))))))....
Thermodynamic Ensemble Prediction
((((((((..(((((....)))))(((((((.(.((.(((((,{(((((.({,({(.{{(.(((({,((..((((.....))))..))))))).))),).).)).{((.(((((.......)))))))}..}||||},..,,,}.((((((((.(...(((((((..(((,....,))).))).))))...}.))))))))..))))))).).)))))))((...(((..((((.(((((((.(((....))))))))))))))..)))....))(((((.(((....)))..)))))(((((.((.,...((((((..((((((({.|,((((....)))).{{,((({{{{({|||||((((({((((,{((.({{{{{.((((((((((({.(((((....{,,,.(({((..{(((((((((({(((..{(((.{(..({{...(((((((.((((((((...(((({....(((....|{{..{,,...,|,.}},.......,|({...,|,.,,,..,,|,,...,....,.,}}......|||,,.,,,....{,.....,,.)))....}))))...)))))))).))))))))))..},.))))},)),,...(((((.(((((..(((((,.,((((((....((((((....)))))).....)))))).,..))))),,..,,.||....},.,.}.((((((...........))))))...))))).)))))((((...))))...((((((((((((..({(((({.((((((..(((((......)))))...(((((.......((((((.,,.,....,||,,..}......(((((((((((..(((((((.....((((....)))))))))))((((((((((((((({(((((((({...}))))))))|,((,,.,,.,,,}},..,}},..(((((...)))))(((((((........)))))))...))))))))))))).)){((((.((((.......)))).))))}..(((((.,.(((...........)))..)))))((((((......((((((((...((((({.,(((.....|,|}}))))}(((....)))((((..........)))),,.......,..)))))))).,.((((.({(((((..(((({....))))).,(((((...((((((({,,,,...((((((((((((((.((((((.......(((((..............)))))..{((({..,,.((((((.((((.(((((....)))))(((((((((((((((((((((..,,.((((((((((..............................................((((((((.....{.((({..{..((((((((((.........))))))))))..}...,))))}.....)))))))).((((,,(({........)))))))).....(((......,(((({.,..,,,,.}},..,......,}},)),))))}.......)))...((.....)))))))))))),}.)))))))))...))).....))))))))).)))).)))))).......)))))..((((((........))))))........)))))).)))))))))))))){{....|||...|,}...(((((..(((((((((..,..{((({....)))),((((..((((((.(((({..........))))}..))))))..))))((({.....)))).........,,},||,...{.(((((....))))).}}}..)))))))))..))))),,)),.(((((((((((((.....(..((((...((((.....(((((((((....))))..)))))....))))))))..}..)))))))).)))))...((((((....((((.....))))((((((((((,,....(((.((({{(((((((.((,{((,{({{..,||,}}},..((((....)))}.,........}}|}{(((((.((((((.....)))))))))))}..((.(((....))))).,{{,{{{,,,,||,.,,,.....,}})))))),)).)))))))))))........{(((.,{.(((((((.........(((((((..,.............)))))))......))))))).}..)))}...(((.(((.........))))))..)))....,..))))))))))...))))))(((....)))((((((((((((..,,.((....)).,,..))))))},))))).........)))))))))))))))))}..})))))...............((((....))))..)))))))))))))))))..)))))).........))))).))))))...})))).))...(((......)))))))))))))).(((((((((.((...((((((((..,.(((((....)))))...)))))))).,...{{{,,,.,,,,,.},}},.,},,,,..{||......................}}}............,,.)).)))))))))(((.(((((((((((....((((.........)))).))))))))))).)))(((((.......)))))...))))))))))),}}),.)}........))))).}.))))..........))))))),{{{|,.,,,,.{{|||,,,.||||....(((((........)))))..(((({{...}))))}.,{{{...(((..,,|}},,,,,{{{,{{,|,||||||,.})}},.,|||||{{,(((.{((({.....))))}.)))..,,..,}}}}}}{((((((.((((((((((,....(((((((((..,..(((..((((((((((..((..((((((((((.(((({.........,,,.({{{...{((,((((..{{{{{,,,..,{((({,(((((.(((((..((((,......,((((((...{((((((((..(,((({{.(((((((..((((((....((((((((((.,,(({....})).}.))).)))))))))))))..)))).{{((((((((.((((((.......((.(((((({..,.)})))..}}}}..((.((((.......)))).)).,.(((((((...)))))))..)))))).)}....})))..,)))}}....,,....,,})).,)))),.))))},,..,})...)))))))))).))))).))))).,))))}..,,,....,|,,((({{({,{|((((((((((((((,{(((((((..........)))))))},..)))))))))).)))},,......(((((((((.,,.....|||,....,,,((({{{,||,,,....}}.)))}}}..(((((((..........))))))).)))))))))(((....))){((.(((((..((((((((....))))))))..))))).)),.((((,,({,..}..,,}).))))))),.....}))))..)))).}}}.,,,,))))).)).)))))))).))..))))).)))))..)))..,..))))))})))..{((((....)))))))))).)))))))))))}..}}}||||{.|||{{(((,|({.(({.{{.|||.||,..,)).)),..|,||{}}}..)),.))}}),))).))))}........................}}}}..|}}|||}}{|,||,}||,|||||.((((((,...,,..|{.(({{{{.,}})},))))))))){{{{....||||....}}})},},}}|||{||||||.,.,}},}}....{{({{{{.{{{{,............))))),))).))))))))))))),|,,,.,}))))))).))))))..)))))))|,......},))))))))....((((((((((((((..((.((....))..))..))))).)))))))))..............{((((((((.(....,(((,....)))}.(((((((.{((...(((((((.......))))))).))}))))))).(((((((((.((((.((.{(((.........))))..)))))).))))))))).......).))))))))}....

Transcripts

ID Sequence Length GC content
GUUCGCGCGACGACCGCGGGGUCGGCGGGCGGGGCGAGGCCCUGGACGG… 4259 nt 0.4717
Summary

This gene, a member of the SNAP25 gene family, encodes a protein involved in multiple membrane trafficking steps. Two other members of this gene family, SNAP23 and SNAP25, encode proteins that bind a syntaxin protein and mediate synaptic vesicle membrane docking and fusion to the plasma membrane. The protein encoded by this gene binds tightly to multiple syntaxins and is localized to intracellular membrane structures rather than to the plasma membrane. While the protein is mostly membrane-bound, a significant fraction of it is found free in the cytoplasm. Use of multiple polyadenylation sites has been noted for this gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the SNAP29 in microglia, where it is involved in the autophagy pathway [Oladapo et al. DOI:10.3390/Ijms26020649].