| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUUCGCUCCGUGUCCCGCUGCUGCUCCUGUGAGCGCCCGGCGAGUC… | 3448 nt | 0.5452 |
This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
A study in mice and rats demonstrated that the SND1 was identified as a downregulated same-trend differentially expressed gene in the corpus cavernosum of animals with age-related erectile dysfunction, where multi-omics analyses revealed conserved molecular mechanisms involving downregulation of mitochondrial activity and disruption of protein homeostasis [Long et al. DOI:10.1093/sexmed/qfaf078].