| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGUCACGUAACGGAGUGGCCAACGGCCUGCAGAGCAACAUGCCCAAGU… | 806 nt | 0.4950 |
This gene encodes one of the specific protein components of the U1 small nuclear ribonucleoprotein (snRNP) particle required for the formation of the spliceosome. The encoded protein participates in the processing of nuclear precursor messenger RNA splicing. snRNP particles are attacked by autoantibodies frequently produced by patients with connective tissue diseases. The genome contains several pseudogenes of this functional gene. Alternative splicing results in a non-coding transcript variant.[provided by RefSeq, Oct 2009]
No relevant information is available at the moment.