Basic Information

Symbol
SOCS1
RNA class
mRNA
Alias
Suppressor Of Cytokine Signaling 1 SOCS-1 SSI-1 TIP3 JAB Cish1 STAT-Induced STAT Inhibitor 1 Tec-Interacting Protein 3 TIP-3 SSI1 Cytokine-Inducible SH2 Protein 1 STAT Induced SH3 Protein 1 JAK Binding Protein JAK-Binding Protein AISIMD CIS1
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_003745.2
Sequence length
1238.0 nt
GC content
0.6616

Transcripts

ID Sequence Length GC content
GAACAGAGCGAGCUGCGGCCGUGGCAGCUGCACGGCUCCUGGCCCCGGA… 1238 nt 0.6616
Summary

This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008] CIViC Summary for SOCS1 Gene

Forensic Context

A study in humans demonstrated that the SOCS1 was significantly expressed in NK cells from acute myocardial infarction patients without plaque rupture, where it is involved in the negative regulation of the immune system and is associated with plaque erosion [Qian et al. DOI:10.3389/fimmu.2022.908815]. A study in mice demonstrated that the SOCS1 is a critical negative regulator of interferon-gamma signaling in macrophages, where its deficiency leads to enhanced STAT1 activation and increased production of nitric oxide and pro-inflammatory cytokines, thereby promoting resistance to intracellular pathogens like *Leishmania major* [Alexander et al. DOI:10.1084/jem.20041401].