Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGUCGUAGUCUCCUGCAGCGUCUGGGGUUUCCGUUGCAGUCCUCGGAA… | 895 nt | 0.4425 |
Summary
The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. In addition, this protein contains an antimicrobial peptide that displays antibacterial, antifungal, and anti-MRSA activity against E. coli, E. faecalis, S. aureus, S. aureus MRSA LPV+, S. agalactiae, and yeast C. krusei. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. [provided by RefSeq, Jul 2020]
Forensic Context
A study in mice demonstrated that the SOD1 was under-expressed in liver tissue following neutron exposure, as noted in the introductory and discussion sections of the research [Roudkenar et al. DOI:10.1269/jrr.07078]. A study in mice demonstrated that the SOD1 gene, a reactive oxygen species-associated marker, was expressed higher in monocyte-derived macrophages compared to microglia and was increased in female microglia compared to male microglia after spinal cord injury [Stewart et al. DOI:10.1186/s12974-021-02161-8]. In human traumatic brain injury, the SOD1 mRNA was found to be down-regulated by 50% in patient T6 [Michael et al. DOI:10.1016/j.jocn.2004.11.003].