Basic Information

Symbol
SOD3
RNA class
mRNA
Alias
Superoxide Dismutase 3 EC-SOD Extracellular Superoxide Dismutase [Cu-Zn] Superoxide Dismutase 3, Extracellular EC 1.15.1.1 Testicular Tissue Protein Li 175
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003102.4
Sequence length
1416.0 nt
GC content
0.6836

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-635.30 kcal/mol
Thermodynamic ensemble
Free energy: -656.93 kcal/mol
Frequency: 0.0000
Diversity: 349.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(((((((..(((((((((((((((((((.((((((...((((((((((....))))))))))))))))(((((((((((.....(((((...)))))(((....))).(((((((((.(((.(((..((((....))))..))).)))))))).)))).((((.((((((.....(((..((((((((((((...........((((((((.((((.....)))))))).(((((((..((((((((((((((.((....)))).))).))))).))))......((((((((((((.(((..(((((((.(..(((...)))..))))))))(((((((...((((((((((((...))).)))))).............)))..)))))))((((((...((((......)))).....((((.......)))).((......)).((((...((((((((((..(((...((((((...........((((.(..((((.((....)).)))).).))))......((......)))))))).))).)))))).)))))))).((((((.(((((((..(((..((.(((.(((((((........))))))).((((..((((((((.((....)).))))))))..))))))))))))..))))))).))))))....)))))).)))))))))))))))((((((((.((((.((((.(.((.(((...((((((((((.......((((((((((..(((((((.(..((((((((((((((....))).(((...((((((......))))))..)))..((.((.((((.(((...)))..)))))))).))))).....))))))..((((......)))).......).)))))))..)))..((((((....)).)))).....)))).))).......))))))((((((........)))))).....(((((.......)))))..))))...))).)).))))).)))).)))))))).....)))))))....)))).........)))))).))))))))).......)))))))))))))))))))))............................((((((((.....(((((..(((((((((..............))...)))))))......)))))))))).))).....(((((((((......)).)))))))........)))))....((((....))))..))))))))))......))))..)))))....)).)))..........((((..((((......(((((((((..(.(((...))))..))))).......))))......))))..))))....................
Thermodynamic Ensemble Prediction
.(((.(((((((..(((((((((((((((((((,((((({...((((((((((....))))))))))))))))|((((((((({.....(((((...)))))(((....))).(((((((((.(((.(((..((({....})))..))).)))))))).)))){((((.((((((.....(((..((((((((((((....,...,..{,,,((({,((((.....)))))))).(((((((..((((((((((((((.((....)))).))).)))))}}))),,|,.,((((((((((((.(((.{({{{(((,{{.{((,.{|||{,,,||||||(,{{......||,(((((((((...)))}})))))}}}}}}}....,,||||,||||||}{((((((,,((((......))))..,..((((.......))))....},}}))}}||||...||{((((((({.({({{.(((({,.........}}||.|}|,|((((.((....)).)))).}|)|}||,,,|||{....,|||)}}}})}))}|))}})},||}|}}}}.((((((.((((((({{(((.,((,{{(,{{(((((........))))))),((((..((((((((.((....)).))))))))..))))}))))))}..})})))).)))))),}..)))),.})))))))))))))))((((((((.((((.((((.{.((.(((...((((((((((.{.,...(((({(((((.((((({,({({.,{..{{(({(({({,,,.|||.({|...((((((......))))))..},}..((.((.((((.{((...)))..)))))))){|||,,,,.((((.........)))).,.)))}...{{{{,.....)))),}},.}}.}}))},,}))))}))))))))))).))),....,.))))))((((((........)))))).....{((((.......))))}..))))...))).)).})))).)))).))))))))}.,..)))))))...,||,,.....,...)))))).))))))))).......))))))))))))))))))))),....,......................((((((((.....(((((..(((((((,(..............,,.,.))))))}......)))))))))).))).....((((((({{......}}.)))))))........}}}}}....((((....))))..))))))))))......))))..)))))....)),))}{{........((((..((((......(((((((((..(,(((...))))..))))).......))))......))))..))))............,,......

Transcripts

ID Sequence Length GC content
AGGGACAGCCUGCGUUCCUGGGCUGGCUGGGUGCAGCUCUCUUUUCAGG… 1416 nt 0.6836
Summary

This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]

Forensic Context

A study in mice demonstrated that intranasal paraquat exposure induced a time-dependent decrease in the expression of the SOD3 gene during the initial destructive phase of lung injury, classifying it as an early marker of paraquat-induced pulmonary toxicity [Tomita et al. DOI:10.1016/J.Tox.2006.12.005].