Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGACAGCCUGCGUUCCUGGGCUGGCUGGGUGCAGCUCUCUUUUCAGG… | 1416 nt | 0.6836 |
Summary
This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]
Forensic Context
A study in mice demonstrated that intranasal paraquat exposure induced a time-dependent decrease in the expression of the SOD3 gene during the initial destructive phase of lung injury, classifying it as an early marker of paraquat-induced pulmonary toxicity [Tomita et al. DOI:10.1016/J.Tox.2006.12.005].