Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGCCCUGGACCCUCGGCUGGGUAGCGCCACCAGAGCGACCAAACGUC… | 4818 nt | 0.4709 |
Summary
Sorbitol dehydrogenase (SORD; EC 1.1.1.14) catalyzes the interconversion of polyols and their corresponding ketoses, and together with aldose reductase (ALDR1; MIM 103880), makes up the sorbitol pathway that is believed to play an important role in the development of diabetic complications (summarized by Carr and Markham, 1995 [PubMed 8535074]). The first reaction of the pathway (also called the polyol pathway) is the reduction of glucose to sorbitol by ALDR1 with NADPH as the cofactor. SORD then oxidizes the sorbitol to fructose using NAD(+) cofactor.[supplied by OMIM, Jul 2010]
Forensic Context
A study in mice and zebrafish demonstrated that the SORD transcript increased in abundance postmortem, with its specific profile noted in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267]. In a separate study on the blowfly *Chrysomya megacephala*, the SORD gene was identified as an up-regulated transcript in larvae fed different edible oils, with its differential expression validated by qRT-PCR [Zhang et al. DOI:10.1371/journal.pone.0063168].