| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCAGAGCCUGUGCUACUGGAAGGUGGCGUGCCCUCCUCUGGCUGGUAC… | 2296 nt | 0.5427 |
Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.