| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCACAUGCCCAGCGCACGCGGCGCGCCGCCCUGCUAGAAGUUGCAGCC… | 4558 nt | 0.5575 |
This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. In mice, a similar protein regulates the gamma-crystallin genes and is essential for lens development. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the SOX1 was identified as a high-confidence gene in common between mice and humans within the top 10% of genes related to lifetime alcohol consumption in postmortem prefrontal cortex [Farris et al. DOI:10.1038/Mp.2014.159].