| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUGUCACUAGGCCGGCUGGGGGCCCUGGGUACGCUGUAGACCAGAC… | 2346 nt | 0.5818 |
This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. [provided by RefSeq, Jul 2008]
A study in human patients with severe erectile dysfunction demonstrated that the SOX17 showed abundant expression level in a specific endothelial cell subcluster (ECs III) identified as arteriole endothelial cells within the corpus cavernosum [Fang et al. DOI:10.3389/fendo.2022.874915]. A review of single-cell sequencing in mouse models of myocardial infarction identified the SOX17 as a marker for microvascular and arterial endothelial cells, expressed in specific endothelial cell clusters (EC1 and EC2) following cardiac injury [Bian et al. DOI:10.3892/mmr.2025.13680].