Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCGCCGUCCCCACCGCCAUCCGCCCUCCCGGCCUGGCCUGCCCUUGCG… | 1862 nt | 0.6933 |
Summary
This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. This protein plays a role in hair, blood vessel, and lymphatic vessel development. Mutations in this gene have been associated with recessive and dominant forms of hypotrichosis-lymphedema-telangiectasia. [provided by RefSeq, Jul 2008]
Forensic Context
A study in human dermal lymphatic endothelial cells (LECs) identified the SOX18 as a transcription factor involved in PROX1 expression and lymphatic development, as mentioned in the introduction [Ducoli et al. DOI:10.1038/s41467-021-21217-0].