Basic Information

Symbol
SOX2
RNA class
mRNA
Alias
SRY-Box Transcription Factor 2 SRY (Sex Determining Region Y)-Box 2 Transcription Factor SOX-2 SRY-Box 2 Sex Determining Region Y-Box 2 SRY-Related HMG-Box Gene 2 Transcription Factor SOX2 MCOPS3 ANOP3
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_003106.4
Sequence length
2512.0 nt
GC content
0.5068

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-842.30 kcal/mol
Thermodynamic ensemble
Free energy: -890.24 kcal/mol
Frequency: 0.0000
Diversity: 645.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((.((..(((((....(((((((...(((((((((.((.((..((((((((...(((((..((((((((((((..((((...))))((((.(((.((((.((((((.(((((..((((((((((((((.......((((((..(((((((((...))))))))))))))).......................((((((((((((((((....(((((((.(.....).)))))))))))))))...)).).))))))))))))))))))).............((((((...(((((.((((((((..(((.(((((((...(((((((((.((((((((((((((((((....(((((((((((..((........))((((((......((((..(((((((((((((...))))((((...))))((((((((...))))).)))....((((.((..(((((((..((((.((....)).))))...)))))))..)).))))..(((....))))))))))))..)).))......)))))).((((.....)))).(((((((....)))))))...)).))))))))).(((((((......(((((((.(........(((...(.....)...)))......).)))))))((((..(((....(((((((((.(((((........))).)).))))))))))))..)))).....))))))).......(((((.((((((((.....((((((.((((..(((...((((((.((.((((....(((....((....(((((..(..(((((((((......((((((.....((((((((((..(((((((((((((((.((((((((.(((((.(((..(((((...(((.......(..(((((((...(((((.........)))))....)))).)))..).))))))))..))))).).)).))))))))........((((.((.((((..(.((((.....))))))))).)).)))).)))))).........)))))..)))).)))))).......))))....)).))))......))))).))))..)..)))))...))...)))..)))))))))))).))).)))).))))))....)))))).))...))))).((.(((((.(.(((.((((((((((((.((((((..(((........((((((((((....))(((((.....)))))...))))))))((((.((((((((...(((((.......((.(((.......)))...)).......).)))).)))))))))))).(((((......((((...))))...(((((....))))))))))....)))..))))))))))).))).(((((...)))))..))))..))).).))))).))......)))))).............((.......))(((.(.(((((((((((..((((......................((((........)))).....(((...................))).(((.......)))...............(((((....))))).))))....))))))))))).)))).(((((......)))))....)))))))).)))).)))))))))..))).((((...........)))).......(((((....((((((...))))))...)))))..(((((((..(((((((.....)))))))..)).)))))...........))))))).))))..)))).)))))...(((((((((.(((........((((((((((((.((((.............((((((.((((((((((..((((....((.........))(((.((((..(((((((...)))))))..)))).)))....((((((((..........))))))))..........(((........))))))).)))))))))).)))))))))).))))))))))))..))).)))))))))......))))))...)))))..)))))))))).))).))))..(((.(((((......))))).))).((((.....))))..(((((((.(((.......(((....)))(((((......((((......))))......)))))...)))))))))).........((((((.(((((((((...((((((((((((..............))))))))...)))).....)))))..)))).)))))).)))))))).........(((((.((((....)))).))))).)))).)))))...))..)))))))).))))).)).)))).)))))))))))).)).))......(((((.(((((((((...((((((((((((...............))).)))..)))))))))))).))).)).)))...
Thermodynamic Ensemble Prediction
{{{((,{{..{{{{{....(((((((...(((({{(((.{(.((..((((((,,.,,(((((..(({{{{{((((({,{({{,..,,}|{{(({(({.{({{.{({{({|({{{{..((((((((((((((.......((((((..(((((((((...))))))))))))))).......................(((((((((((((((({..{(((((((.{.....).)))))))))))))))...)).)}}))))))))))))))))))...,.......,,|(((((,{.{(((({(((((((({.,{{,||||||,...(((((((((.((((((((((((((((((,,..((((((((({({.{{........||((((((.,....((((..(((((((((((((...))))((((...))))((((((((...))))).)))....((((.((..(((((((..((((.((....)).))))...)))))))..)).))))..{{{..,.))))))))))))..)).))....,.)))))).((((.....)))),(((((((....))))))).}.)).))))))))).(((((((..,...(((((((.{....|,..{,,...,..||.||.,.}|.,,...,.)))))))((((..(((...,(((((((((.(((((........)))}}).))))))))))))..))))..}..))))))).......(((((.((((((((.....((((((.((((..(((...((((((.((.((((....,{{,,,.{,....((((({{((.(((((...)))))))))))))....,...,(((((,,((({(((((((((((({((((((((.(((((,(((..(((((,,.(({....,,.,}}{{{{{{(...(((((......,..}}}}}...,)})).)))....}}})))))..),)))}).)).))))))))....,((,((((.{(.((((..,.((((.....))))})))).)).)))}.))},,|{{{{{{...,},.,..}....))),))}}............})).,)))}}}))...}}.}))))).))}}}..(((((...))))).)))))))))))).))).)))).))))))....)))))).))...))))).((.(((((.(.(((.((((((((((((.((((((..(((..,{{{..((((((((((....)}(((((.....)))))...))))))))((((.((((((((...{{(((,,.....((.(((.......)))...)).......).)))),)))))))))))).,((((......((({...})))...(((((....))))))))))}.,,)))..))))))))))),)},.{((((...))))}..))))..))).).))))).))....}.)))))).............((......,)}(((.(.(((((((((((..{(((..........,,,.........((((........)))).....{|{...................,,|.(((.......))).,,.......,....((({{....)))}).))})....))))))))))).))}}.{{{{{.....,}}},.....)))))))).)))).)))))))))..,}|,,{{{,,,.,,.,}||}})},,,,...(((((....{(((({...,})))}.,.)))))..(((((({{{(((((((,...,))))))),,)})))))).....,,,,,|||||},|{|},,..}})},}}},,...{(({{{{{{.|||,,,.,,..((((((((((((.((((.............((((((.{(((((((((..{{{{...{((,{(((({..,,(({.{(((..(((((((...)))))))..)))}.}))}}}}|{|||||{..........)))))))}....,,....{{{........))),,,,.)))))))))}.)))))))))).))))))))))))..,,,.,}}}}}}}|,,..,.})}}}}...))))).})))))))))).,}},}}}}|{((({(((((......}}}}},}}}.{(((.....)))}..|{{{,{{{({(,,..,,.(((,,..}}}{||||}.,,,.,|{{..}},,)))),},,,.,,}}}...}}}}}}}}}},,||,,....((((({((({{,,,,.{{{{,.,,||||||.,,}}}}})}}}..}}}}}})},},}}},.}}}.},))}}})}}},||}}}}.}}}))))}.......{.{((({.{{{,....}))),)))))})))).))))}...}}..)))))))).)}))).})})),}.))))))),}}}),)),),......((((,.(((((((((...{{{{{((({(((.{,,.......}}..))).)))}.,}}))})))))).))).}).)))...

Transcripts

ID Sequence Length GC content
GAUGGUUGUCUAUUAACUUGUUCAAAAAAGUAUCAGGAGUUGUCAAGGC… 2512 nt 0.5068
Summary

This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]

Forensic Context

A study in human postmortem brain tissue from subjects with opioid use disorder (OUD) identified the SOX2 as a coding RNA that was upregulated in OUD and is involved in developmental processes and cell stemness modulation [Mendez et al. DOI:10.1038/s41380-021-01259-y]. Separately, research using human menstrual blood-derived mesenchymal cells (MBMCs) demonstrated that the SOX2 gene, both as an endogenous pluripotency marker detectable in MBMCs and as an exogenous reprogramming factor, was successfully used to generate induced pluripotent stem cells with high efficiency and rapid colony formation, where the exogenous transgene was subsequently silenced in established cell lines [de Carvalho Rodrigues et al. DOI:10.3727/096368912X653048].