Basic Information

Symbol
SOX4
RNA class
mRNA
Alias
SRY-Box Transcription Factor 4 SRY (Sex Determining Region Y)-Box 4 Transcription Factor SOX-4 SRY-Box 4 Ecotropic Viral Integration Site 16 SRY-Related HMG-Box Gene 4 IDDSDF CSS10 EVI16
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003107.3
Sequence length
4869.0 nt
GC content
0.5252

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1832.50 kcal/mol
Thermodynamic ensemble
Free energy: -1918.38 kcal/mol
Frequency: 0.0000
Diversity: 1257.18
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((..((((((((((((.(((..(((.((((((((((((((((((((.........)))))))))..))))((((.(((((...))))).)))).((((((....))).)))...((..(((((((((...)))))))))..)).............))))))))))))).)))).)))).))))...))).........(((((........))))).......(((((((((((((((.......).))))).....((((((((((((((.((((((((...((((((((.(((..(((.......)))..))).))))))))(((((((((((((.((((((((((((..((((((.((((((((.............................((((.((((((.(..(((..(((..(((..((....))..))))))...((((......))))...)))..).)))))))))).(((.((((.(...(((....)))...).))))..))).(((.(((.(.((((((((((((((((((((...((((........))))))).)))))..(((....))).((((((((...))))))))....))))))))).))).)))))))))))).))).))))))....)))))))(((((..(((.(((.(((((..((((((((((......(((((....)))))..((((((((....(((.((((.((((((((..........)))).)))).)))))))...)))).)))).((((.......)))))).)))))))).....)))))))))))))))).))))).))))((.((((((((.((((((.((((((((...................))))))))..((((((....))))))..)))))).)).))))))))(((.....)))..(((((((.((.....((.(((((((((....))))))).)).)).(((..(((.(((((((...........)).))))).)))..))).....((((((........(((((.((((...(((((((.((((((...)).)))).........((((((....))))))(((.((((((((.......)))((((((((.(..(((((.((((...((((((((..(((.(..((((..((...))..))))..))))..((((((((...))).(((((((.....)))))))..)))))....))))))))...))))))))))))))))))((((((((((((((((.(.((((.((...(((((((((.(((((((((.(((((((((((((((((((...........(.(((((........))))).).(((...))).((((((((.(((((((((((((....))))....((((.........))))((((((((((((((((.(........).))))))))))))))))((((((((........)))))))))))))))))))))))))...)))))))))))).......))))........((((((((....)).))))))(((((.((.((((((((((((..(((((.(((((.((.(.(((.(((((((((..((.((.(((.(.(((..((((((......)).)))).)))..).))).))))(((....))).))))).)))).))).).))))))).))))).(((((.(....)))))).)))).)))))))).))((.(((((((..(((.....)))..))))))).)))))))..))).))))))))).)))))..))))..)).)))).))))))).))..(((((((.....)))).))).))))))))).)))).)))))))))).))))..)).)))......))))))...)))))))))(((((((((..(((((((.(((.(((..(((((((((((((((((.((((.....(((((((((.((........(((((...)))))..)).)))...))))))))))))))))))))))).......((((((.((.((.........((((((.......))))))....)).)).))))))....((((.((((((((((((((((((...)))))((((((((((....).))))..))))).........))))))).)....))))).))))...))))..)))))).)))))))..)))))))))((((((((((.(((((((((((..((((((((.(((.((((.(..(((((((((((((((((((((((((..((((.(((.(((((.(((...)))((((((((.(((....)))...))))))))((((.(((...))))))).((((..(((.(((((((((.(((.(.((((((..((((((....((....))..))))))..)).((.((((..(((((.....))))).....((((((((((((....))))))))))))..............((((((((............))))))))..)))).))((((((((((.((.((((((.....(((((.(.((((.(((.(((((((......))))))).(((((((....)))))))(((((....(((((..((((((((((((((((((((.(((...(((...((((((((.((((((..............)))))).)))))))))))..))).)))).))))))))....)))))))).........(((...))).)))))...)))))..((((((....(((...)))(((((.((((((..(((.....)))..))).(((((((((.(((..(..((..((.((((((....)))))).))))..)..))))))))))))...))).))))).))))))((.((.......)).))...(((((((.........))))))).))).)))).).)))))..))))).).))...)))))))))).....((((..(((...((.(((((.(((((.((((((..(((((.(((.........))).)))))..)))))).)))))))))).))..)))..)))))))).).))).))))).)))).)))..))))...(((((((....((((((((.((..(((((((((.(((((((...(((((((((....(((((((((.......((((((((((.....)))))))))).(((.....)))...((((((((((((((....)))))).((((((..((((((((..((((((.(((((..(((((......((((((((((((((((...)))))))).......)))))))).......))))).)))))))))))))))))))....))))))......))))))))...))))))))).((((((((.(((..(((((.(.(((((((.(.((.....((.(((((..............))))).))...............)).))))))))).)))))..))).))...))))))......)))))))))...)))...))))..))))).)))).))...))))))))......)))))))((((...((((.(((....))).)))).))))...................).)))).)))..)))).))))))))))..))))))).))))))))..))))).))))))))))))))))))))))..))))))))))........)))))))))..........(((........))).((((((...))))))..(((((....)))))...........(((((((((((((..(((..(((((((.......((((((((.(((((((((((....((.(((((.(((((((..((((((((((...))))))))))..)))))))))))).))((((((((..(((((.(((((....)))))...)))))((.((((((((.....................))))))))))............)))))))).......((((((....(((((((.((((.(((((((....((((((((((......((((....((((............)))).(((.(...(((.......((((((((((..........)))))))...))).......))).).))).)))).......)))))))........)))..))))))).)))).))))))))))))).....)))))))))))..)))))))).((((((..((((.((....((((((..((((((((((...(((((((..((((..(((((((...)))..))))...)))).))........(((...................)))((((((.........)))))).....)))))...))))).......)))))))))))..)))))).)))))).........)))))))..)))..)))....)))))))))).)))).......)))))))))))))))).)).((((((((......))))).))))))))))))(((.(((((((...)))))))...)))..(((((((..(((......(((((((((.((..(((..((((.......(((.....((((.((......)).))))..))).......)))..)..))))).)))))))))...........((((((....(((((((.....(((.....)))....)))))))...((((((.((((........))))))))))..........))))))))).)))))))...
Thermodynamic Ensemble Prediction
(((..((((((((((((.(({.,(((.((((((((({{(((((((((.........)))))))))..}))}{(((.(((((...))))).)))).((((((....))).)))...((..(((((((((...)))))))))..)).............,)))))))))))).)))).))))}})))...))).........(((((........))))).....,,((((((((({{{{{{,......}.}}))}.,,..{{(((((((((((((((((...{,,,((((((((.(((..(((.......)))..))).)))))))|((({{{{{,{{{{,|||(((((((((,.{(((((,(({(((((,,,,,,,,,,,,,,,,,,,,,,,......(({((((((((,(,{,,.,,|||..(((..((....))..))))},...((((......))))....,,..}.}))))))))).(((,{(((.{...(((,...}})..,|,|||||,}.|,(((.(((.(.((((((((((((((((((((...((((........))))))).)))))..(((....))).((((((({...})))))))....))))))))).))).)))))||||||},||}.}})))),,,,)}}))))|{{||||||||(((.(((((.{(((((((({(,.,,,,(((((....)))))..((((((((..{{({(,((((.((((((((..........)))).)))).)))))))})})))).)))).{(((.......})))))}))))))),...,,)))))))))))))}}}}))}}).)}}|((.((((((((.((((((.((((((((....,.............,))))))))..((((((....))))))..)))))).)).))))))}}({{,,...}}}..(((((((.((.....((,((({{{{{(,,,,,}}}})),)),)),||{,.(((.((((({{...........||.}}})).)))..))).....((((((........(((((.((((...(((((((.(((({{...,}.)))).....,...{{{{{{....}}||||((|{(||||}{|}},,,..}}.((((((((.{..(((((.((((...((((((((..(({.{..((((.,((..,||..))))..))))..|||||,|||,.||}.(((((((.....)))))))..))}}}.|..))))))))...)))))))))}))))))))(((((((((((((((({(,((((.((...(((((((((.(((((((((.((({,{(((((((((((((...........(,(((((........))))).).,,....}}|.((((((((.(((((((((((((....))))....((((.{.......))))((((((((((((((((.(........).)))))))))))))))){(((({((,,,.....))))))))))))))))))))))))),,.)))))))))))),..,.,,}}}},,,,,...((((((((....)).))))))(((((.((.((((((((((((..(((((.(((((.((.(.(((.(((((((((..((.((.(((.(.(((..((((({......}},)))).)))..).))).))))(((....))).))))).)))).))).).))))))).))))).(((((.(....)))))).)))).)))))))).))((.(((((((..(((.....)))..))))))).)))))))..))).))))))))).)))))).}))}..)).)))).))))))).}}..{((((({.,,,.}}}}.))).)))))}}})}))))})),))))))).))))..)).)))......))))))...)))))))))(((((({{(,,(((((((.((({(,({.((({((((((((((({{.((((.....((((((({,,{(.....,,|((({,...,})}),,},.)))..,))))))))))))))))))))))).....,.((((({.((.((........,|{||||||,..,|||||||....}),)).}}))))....((((.((((({(((((({(((((...)))))((((((((({....).))))..))))).........})))))).)....))))).))))..,)))}},,))))).))))))).}))))))))){{((((((((.((((((((((({.,{((((((.(({.((((,(..{((((((({(((((({((((((((({{,,,{...({.(((({{{{.,{|||{(((((((.(((...,}}}...||||||||||||.||,..,).)))))|||||..(((.(((((((((.((({.{((({{(..(((({(||.,((||||}}.||}||||{.||,{(,((({..(((((.....))))).....((((((((((({....})))))))))))...........,..(((({(((,,,.,,,.,,,,}}}}}}}}.,}||},}}|(({(({{{{.||.{|{((||,.{{{{{(({(.((((.(((.(((((((......))))))).(((((((....)))))))(((((....(((((..((((((((((((((((((((.(((...{{,...((((((((.((((((..............)))))).)))))))),,},.))).)))))))))))))....)))))))).........(((...))).)))))...)))))..((((((....(((...)))(((((.((({,,..(((....}))).,}},.,{{((((((,(({.{(,{(({,((,((((((....)))))).)).}..,..))))))))))))...))).))))).))))))||.{{......,)}.,}...(((((((.........))))))).))).)))),)}))))))}))})).,.})|,|)}))))}})),,...((((..(((...{{.(((((.(((((.((((((..(((((.(((..,......))).)))))..)))))).)))))))))).}}..)))..))))}))).).))).))))).)))).))),.))}},|,(((((((,...{{((((((,{{..,{{{(((((.(((((((...(((((((({....({,,{{(({.......{(((((((((.....)))))))))).,....,{{{,....,||||((((,{{({,.{((((..,.((((((((((((((((,,((((((((({((,,.((((({{,{,(,(({{{((({{{{{|...))))))))}},,,,}),})))))}}}},).,,,.|,}}}},},)}))))))))))}))})))}))...))))),)})})),,},|||||||{((,{{,((.(({..(((((.,.((((((({(.{({{,.,((.(((((.,,,.....,,...))))).))...,,,,.......,}),}))))))),.)))))..))).}}.}}))))))}}..,.}))))))))...))),..}))),.))))).,,}}.)}...)))))))}......}})))}}((((....{{(,{||,.}})}}.,,,}.})))...,,...}}}}}}}}}}).})))))))))))))).}}))))))}}..})))))).)))))))}..))))}.)))))))))))))))))))))),.})))))))))}}},,,,,}})))))))|.,,......{{(,,..,..,|||,{(((((...)))))},.{((((,,..||,||{{{......,.{,|||||{|||||||||{|.|.{{{||.......,{{|||||.{{{((((((((,...,,.,{{{||{{|||||,.((((((((({...})))))))))..))))))))}}}},||({({((({{.{{{,,.{||||,,||}}}},...}}))|((.((((((((.............}.......)))))))))),......,}}}.))))))},.......(((((({{,.(((((((.((((.(((((((....((((((((((.......((((..,((({............)))).))))....,{,.......,|,((((((({..,,....,,.,|||||....,,}}..,}},,.,.},.,)))))},....)))))))........)}}..))))))).)))).))))))),,|||}.....}},,,,||||,(((((((((((((((((..((((.((....((((((..((((((((((...(((((({..((((..(((((({...,))..})))...}))).,,........(((...................))){((((({{....,},}}}))).....)))))...))))).......)))))))))))..)))))).)))))).....))))))))))).}))|,,....}}}}}}...))))}))))..,}}},)))))))))))))))).}}.((((((((......)))))}})}))))))))){((.(((((((...)))))))...))}..(((((((..((({{{...(((((((((.((..(((..,(((.......(((.....((({.{{,.....}},))))..))).......)))..)..)))))}))))))))).,}}},.....((((((,{{,,(({(({,,...{,|,.,}.))),,,.}}}}}}}...((((((.{(((........))}})))))).......,,.)))))),,,.)))))))...

Transcripts

ID Sequence Length GC content
GCUCUAAGCUGCAGCAAGAGAAACUGUGUGUGAGGGGAAGAGGCCUGUU… 4869 nt 0.5252
Summary

This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins, such as syndecan binding protein (syntenin). The protein may function in the apoptosis pathway leading to cell death as well as to tumorigenesis and may mediate downstream effects of parathyroid hormone (PTH) and PTH-related protein (PTHrP) in bone development. The solution structure has been resolved for the HMG-box of a similar mouse protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human cord blood hematopoietic stem cells from identical and fraternal twins demonstrated that the SOX4 showed high expression differences in both twin types and was placed in Group C, indicating environment and genetics have the same kind of effect, with identified target genes including RBM14, PTK4, SOX4, B2M, KLHL28, and POU2F1 and involvement in the P53 signaling pathway [Ajami et al. DOI:10.22074/cellj.2019.5683].