Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCUAAGCUGCAGCAAGAGAAACUGUGUGUGAGGGGAAGAGGCCUGUU… | 4869 nt | 0.5252 |
Summary
This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins, such as syndecan binding protein (syntenin). The protein may function in the apoptosis pathway leading to cell death as well as to tumorigenesis and may mediate downstream effects of parathyroid hormone (PTH) and PTH-related protein (PTHrP) in bone development. The solution structure has been resolved for the HMG-box of a similar mouse protein. [provided by RefSeq, Jul 2008]
Forensic Context
A study in human cord blood hematopoietic stem cells from identical and fraternal twins demonstrated that the SOX4 showed high expression differences in both twin types and was placed in Group C, indicating environment and genetics have the same kind of effect, with identified target genes including RBM14, PTK4, SOX4, B2M, KLHL28, and POU2F1 and involvement in the P53 signaling pathway [Ajami et al. DOI:10.22074/cellj.2019.5683].