| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAGAGCCGAAAGCGGAGCUCGAAACUGACUGGAAACUUCAGUGGCGCG… | 3931 nt | 0.5106 |
The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the SOX9 was significantly altered in expression on day 4 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].