Basic Information

Symbol
SPANXB1
RNA class
mRNA
Alias
SPANX Family Member B1 CT11.2 SPANXB2 SPANXF1 Sperm Protein Associated With The Nucleus On The X Chromosome B1 Cancer/Testis Antigen Family 11, Member 2 Nuclear-Associated Protein SPAN-Xb Cancer/Testis Antigen 11.2 SPANX Family, Member B2 SPANX Family, Member F2 SPANX Family Member F1 SPANX-B SPANXF2 SPANXB Sperm Protein Associated With The Nucleus, X Chromosome, Family Member B1 Sperm Protein Associated With The Nucleus On The X Chromosome B/F Nuclear-Associated Protein SPAN-Xf SPANX Family, Member F1 SPANX Family, Member B1 SPANX Family Member B/F B1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_032461.4
Sequence length
466.0 nt
GC content
0.4893

Transcripts

ID Sequence Length GC content
ACCAGGAGGGUAUGCAUAGGGAGGGCAAGAGCUCUGGGCCACUGCGAAG… 466 nt 0.4893
Summary

Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular family member contains an additional 18 nucleotides in its coding region compared to the other family members in the same gene cluster. This family member is also subject to gene copy number variation. Although the protein encoded by this gene contains consensus nuclear localization signals, the major site for subcellular localization of expressed protein is in the cytoplasmic droplets of ejaculated spermatozoa. This protein provides a biochemical marker for studying the unique structures in spermatazoa, while attempting to further define its role in spermatogenesis. [provided by RefSeq, Apr 2014]

Forensic Context

A collaborative study evaluating mRNA multiplexes for body fluid identification in human forensic samples noted that the SPANXB1 was evaluated in a preliminary study but gave inconsistent results during singleplex testing and was not included in the validated semen pentaplex used in the main exercise [Haas et al. DOI:10.1016/j.fsigen.2012.10.011].