| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGGUCGAUGCAGCUGUAGUGACAAUCUCAGAGCAGCUUCUACACCACA… | 554 nt | 0.4404 |
Predicted to enable serine-type endopeptidase inhibitor activity. Predicted to act upstream of or within inflammatory response and negative regulation of cytokine production involved in inflammatory response. Predicted to be located in extracellular space. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the SPINK7 mRNA is abundantly expressed in both saliva and vaginal secretion, with greater read fractions in saliva, and exhibits cross-reactivity with menstrual blood [Yu et al. DOI:10.1016/j.fsigen.2025.103416].