Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAUUCCCACCACCCACCUCUGAGCCCAGCCCUCCCUAGCAUCACCACU… | 7300 nt | 0.5204 | |
| AGUCUUGCCCCAGCCUCGGGAGGUGGUGGAGUGACCUGGCCCCAGUGCU… | 7252 nt | 0.5207 |
Summary
This gene encodes a highly sialylated glycoprotein that functions in antigen-specific activation of T cells, and is found on the surface of thymocytes, T lymphocytes, monocytes, granulocytes, and some B lymphocytes. It contains a mucin-like extracellular domain, a transmembrane region and a carboxy-terminal intracellular region. The extracellular domain has a high proportion of serine and threonine residues, allowing extensive O-glycosylation, and has one potential N-glycosylation site, while the carboxy-terminal region has potential phosphorylation sites that may mediate transduction of activation signals. Different glycoforms of this protein have been described. In stimulated immune cells, proteolytic cleavage of the extracellular domain occurs in some cell types, releasing a soluble extracellular fragment. Defects in expression of this gene are associated with Wiskott-Aldrich syndrome. [provided by RefSeq, Sep 2017]
Forensic Context
A study in mice demonstrated that following clodronate pre-treatment and controlled cortical impact injury, monocytes exhibited a reduced expression of the SPN (Spn), which is a surface protein marker associated with non-classical monocyte identity [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8]. This transcriptional shift was part of a broader immunoregulatory response characterized by the emergence of distinct monocyte subsets, including a neutrophil-like population, which collectively promoted tissue protection, stabilized the blood-brain barrier, improved cerebral blood flow, and reduced pro-inflammatory cytokine expression in the injured cortex.