| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUCAGCGCAGCUCCGCGGCCGCCAAGCCGAGGCGGGCACGGUCUCCG… | 5052 nt | 0.4850 |
Predicted to enable LBD domain binding activity and metal ion binding activity. Predicted to be an extracellular matrix structural constituent. Predicted to be involved in cell adhesion. Predicted to act upstream of or within negative regulation of amyloid-beta formation; positive regulation of amyloid precursor protein catabolic process; and positive regulation of protein processing. Located in collagen-containing extracellular matrix and extracellular space. [provided by Alliance of Genome Resources, Apr 2025]
A study in humans demonstrated that the SPON1 was downregulated during continuous weight loss from 5 to 12 months in weight losers [Bollepalli et al. DOI:10.1038/ijo.2017.245].