| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGUUUGAUAAAGACAGCUCCUCUUAGGAAGAACUGUCAUCCCCAAAC… | 1021 nt | 0.4525 |
This gene encodes a secreted phosphoprotein that is a member of the cystatin superfamily. [provided by RefSeq, Oct 2008]
A study in human cadaveric liver tissues demonstrated that the SPP2 is one of eight liver-specific gene biomarkers used in a targeted massively parallel sequencing (MPS) assay for organ tissue identification, with the assay successfully identifying liver as the tissue source in all 27 analyzed samples with 98–100% of sequencing reads mapped to these biomarkers [Javan et al. DOI:10.1038/s41598-020-63727-9]. A review of forensic transcriptomics confirms that the SPP2 is an established mRNA marker used in targeted MPS assays for the specific identification of liver tissue, which is part of high-resolution applications for body fluid and tissue identification in forensic genetics [Haas et al. DOI:10.1016/j.fsigen.2021.102486].