Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUGCGCUCCACCCCAGUGGCUGGAGGAGCAGCUCUCCAGUCAGCCUUU… | 7270 nt | 0.3630 |
Summary
The protein encoded by this gene is a member of the Sprouty family of proteins and is phosphorylated by tyrosine kinase in response to several growth factors. The encoded protein can act as a homodimer or as a heterodimer with SPRED2 to regulate activation of the MAP kinase cascade. Defects in this gene are a cause of neurofibromatosis type 1-like syndrome (NFLS). [provided by RefSeq, Jul 2008]
Forensic Context
A study in mice demonstrated that exosomes derived from hypoxic mesenchymal stem cells (Hypo-Exos) significantly promoted bone fracture healing by enhancing angiogenesis, endothelial cell proliferation, and migration compared to normoxic exosomes [Liu et al. DOI:10.1016/j.actbio.2019.12.020]. In a rat model of pulmonary arterial hypertension-induced right ventricular failure, transcriptomic analysis identified the SPRED1 as a gene whose epigenetic downregulation is associated with increased angiogenesis and improved right ventricular function [Potus et al. DOI:10.3390/ijms19092730].