Basic Information

Symbol
SPRED1
RNA class
mRNA
Alias
Sprouty Related EVH1 Domain Containing 1 PPP1R147 SPRED-1 Sprouty-Related, EVH1 Domain-Containing Protein 1 Protein Phosphatase 1, Regulatory Subunit 147 FLJ33903 HSpred1 Suppressor Of Ras/MAPK Activation Spred-1 LGSS NFLS
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_152594.3
Sequence length
7270.0 nt
GC content
0.3630

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1912.40 kcal/mol
Thermodynamic ensemble
Free energy: -2048.02 kcal/mol
Frequency: 0.0000
Diversity: 1853.13
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((.((....)).)))))(((..((((((((((((((....((((((..((((((((((((........)))((((((((((((((..((((..(((((.((((((((((.(.(((.(.((.((((..(((((((((.((.((.(((((((((....))))))))).(((...)))(((((((((((((((((..((((((...))))))..)))))..(((......)))...((....)))))))))))))))).)).)))))).)))....)))))).).))).)))))))))))(((((..(((((((((((((..((((.....))))..))...)))))...)))))))))))((((...............)))).......))))).))))..)).)))...)))))......((((((((((....))))))))))))))(((.(((((((((((.....))).)))...))))))))...)))))))))..))))))))))))...........))))))))..)))............(((((((((((((((((..........(((((.(((...))).)))))...(((.((((((((((((((((((.((((.(((....((((((((....((((((.((((((((....)).))))))((((((.(.(((((((...(((..(((.....)))..)))..))))))).)..))))))...))))))(((((..(((((....((((((((....((((..(((((((((((....)).).))))))))..))))........(((((((..(((((((((((((.........)))))......(((...(((((((((.....((((.....)))).((((((((((((((((((..((..(((((((...)))))))..))..)))))((((.(((......)))(((((.....)))))...(((.....((((.......)))).)))....))))...(((((((((..(((((......)))))...(((.((......((((....((((((.(((.((........))..)))))))))...)))).....)).)))...((.(((((((((((.(((((((.(((.((((((..((......))..))))))...))).)))))))...((((.(((..........))).))))...((((.((((..((((.((......)))))))))))))).(((.(((((......(((((((((((...............))))...............(((((((.....))))))))))))))....))))))))....(((((.(((.......)))))))).....)))))))))))))...)))))))))....((((((...............(((((((((......)))))))))))))))..))))))).)))))))))))))))....)))......((((.....))))(((((.(((.(((((...))))))).).)))))..)))))))).)))))))(((((((.((.((((.(((((.(((((..(((...((((((((((((((((((((((.(((..(((((.((((.(((((((..((((..((((((((((......)))))))(((((((.((........))...(((((((.(((((..........))))).)))))))))))))).)))..))))...))))))))))))))))...)))))).)))((((((...((((((....))))))((((((...))))))........))))))....)))).)))))))))))).....))).)))))))))).))))...)).(((((....)))))...(((((......)))))((..(((((.((((((.........)))))))))))..)).....(((((....))))).(((((((.((.((((((..(((((.(((......((.(.((((((((((((((..(((((((((((((((((((.(((((.....((((((((((..((((((....((((.....))))..))))))(((((((........)))))))............((((....(((((((((.....)))))))))..))))..((((((...........))))))....))))))))))....((((((....(((((((((((((((....)))))))))))).)))((((((((.......((((((((((((.....)))))..))))))).......))).)))))...(((.....)))..((((..(((((((.....((((....))))((((((((((((.(((((.(((.............................)))..))))).....((((......)))).)))))))))))).....(((((((....))))))).....((((......))))))))))).)))).........(((((((((((.((.((((....)))).)).)))))))))))......((((((((((((((((((.(((...((((.((((((((..((((((..(((((((((((((((((((((((..((..(((((((((.((((..((((....(((((((..((((((.(((((.(((.(((...(((.(((........))).))).))).)))..((((((((((((.((((.....(((((......(((((((((((((......((((((..................)))))).....((((....(((((((...)))))))..))))...........((((..((((((.((((((.((((((((.((((((((.(((.((((((............(((...)))))))))))).)))))))).))))))))....)))))))))))))))).(((((((((((......)))))))....))))................)))))))))).))).....)))))............((((((....((((...(((((...))))).)))).)))))))))).))))))))))))..(((...........))).)))))))))))(((((((..........))))).))......)))))))))))..)))).)))....)))))).))...((((((..........))))))..((((........))))....(((((((((((......((((.......(((((((............((((((((((((((((((((...))))))....))).)))))).)))))............))))))).......))))....((((((...)))))).....))))))))))).....((.(((((.......))))).))(((((.((((((((((......((((((.......((((((.......))))))..........(((((.(((((..(((((((..(((...........))).)))))))))))))))))...(((((...)))))...((((((..((((((..((.((...)).))..))).)))..))))))...........))))))...)))))))))).)))))))))))))).........))))))))))))))......)))))).....)))))...))).).)))...))))))))))))))))))))).....)))))).........))))).))))))............((((((((............)))))))).....((((((.......))))))..))))))))...))))).))))))....(((.......))).........(((((((....))))))).......(((((...(((((((((.(((((((((((((((...(((((((((((((.((((....(((...........(((((.((((((.......)))))).)))))(((.........)))((((((((((((.((((.......(((((........(((((...)))))))))).......(((((((.(((((..((((((((.((((((((.(((....))).)))))))(((((((....))))).))...(((((((((...)))..)))))).).))))))))....)))))))))))).((((((((((((..(......((....(((....)))....))...(((((........)))))((((((.......))))))(((((((.(....))))))))..............(((((((((((((((((((((((.((.....)).)))......((((.(((((((..((....))((((((((.((((((........)))))).)).)))))).))))))).)))))))))))((((.((....)).))))...)))))))).))))))..)))))).)))))))))).))))))))))))(((((((((..((((...((.......(((((...((((((((((((.((((((..((((...(((.........)))))))..((((..(((((...(((.....)))....(((.((((....(((.....)))....))))))).......)))))..))))((((((((.((((....))))))))))))..(((.(((.......))).))).((((((((.....(((((....(((....((((((..((((...(((((...)))))...........(((((........)))))........................(((((.((((.(((........))).)))).)))))...))))..))))))....)))...)))))..((((........)))).((((..((...((((..(((((((.(((((((((.(((.((.......))))).))))..)))))...))))))).)))).))..))))))))))))....(((((((((((((......((......))......))))))))...))))).......)))))).)))....)))))))))))))).)).))))..))))).)))).((..(((((.......))))).))..(((((......))))).(((((((.((.((......)).))))).))))..)))....)))).))))..))))))))).)))))))).....(((.(((((((((........)))))..)))).)))((((((((((((.((((((((((......((((((((.(((((((.((((((((((((((((((((.((((.....(((((.................................))))).....)))).)))))))((((....))))...))))))))))))).(((........)))..((((.((((((((.((((((....((((((((((((..(((....)))(((((.((((.(((((........)))))(((((((((.......((((....(((((((.........)))))))....))))....))))))))).....)))).)))))....((((..(((....)))..))))......))))))))))))..))))))(((((..((((.....((.(((((.(.((.(((((....))))))).))))))))..))))...)))))..((((((((........................((((((....)))))).))))))))........(((((((.....))))))))))).))))))))...)))))))))))))))................))))))))....)).))))))))))))....))))))).)))))))))....)))))............(((((((..(((((((.((..((((((.((((((.(((..((((.((....)).)))).)))...)))))).))))))........((((((((.((((((...))))))...)))))))))).))))))).))))))))))).)))).).))......))).))))).)))))).)))))))))...........(((((((((..((....))..)))).))))).)))))))(((((((((...((...((.....(((((((....)))))))....)).))...))))))))).....(((((((((.....))))))))).)))))))).....)))))..)))))...(((......)))....(((((((..(((...)))..))))))).....(((....((((.....))))..))).)))))))).....((((((((((...((((((((.....(((((((..((.(((((...((((...))))..)))))...))..)))))))......((((((.(((..(....)..))))))))).((((((((....))))))))..))))))))...))))))))))................(((((((.....(((.......((((((((((((...((((((((((((........))))))))))))....((((((.((((((((((..(((((((.((..(((((((..(((....((..((((((((..........)))))))).))...)))..))...(((..((..((((((..........................))))))..))..)))............((((((......))))))((((((((((((((((.....(((((((..(((((....)))))....))))))).......(((.....)))....)))))).))...))))))))..(((((.(((...((((((((..........((.....))..........)))))))).))).)))))............)))))..))))))))).))))))))))..)))))).........((((...))))..)))))))))))).......))).....)).)))))...))).)))).))))).....(((((((..........)))))))))))).)...))))))).)))........))))))))................))))))))).
Thermodynamic Ensemble Prediction
((({(.(((((.((....)).))))),,))}||,,,,,(((((((....((((((..(((((((({(((........))){({{((((((((((.,((((.,{((((.((((((((({,(.{((.(.((.((((..(((((((((.((.((.(((((((((....))))))))).(((...)))(((((((((((({((((..((((((...))))))..))))),.(((......))).,.||....)))))))))))))))).)).)))))).)))....)))))).).))}.)))))))))))(((((,.(((((((((((((..((((.....))))..)),..}))))...))))))))))),.....,,....,......,))}...,...))))).)))),.)).)))...)))))......((((((((({....}))))))))))))}(((.(((((((((((.....))).)))...))))))))...}))))))))..))))))))))))).,,,,.{{{.{||||,,,..}))}.}}}.,},,..(((((((((((((((((..........(((((.(({...})).)))))...,{,{((((,(({(((((((((,,(({(.,(((,,((((((,(({{,,{(((((((({({{((,,,,||.}||||||{{||,.({(((((((...{,{..{{{..},,)))}}))},,}}}|)))||..,|||......{{{{{{...({{{,.((((.((.{({.((....((((..(((((((((((....)).).))))))))..)))).,..))..(((((((..(((((((({((({.,{...,|,))))}......(((.,,(({{{{{{{|},,.((((.....}}}}.{((((((((((({(((((..((..(((((((...)))))))..))..))))}{{{|,{{,,,.{(.,..(((((.....)))))..},||..,,.||||.{{{.,,||||.||}||,,|}}},..(((((((((..(((((......}|}}}..,|{{.{{,,,,,.{{{{,,|.((((({{{((.((........))..})}))))))...}|||.....)).)))...,(,(((((((((((.((((((,.(((.((((((..((......))..))))))...))).)))))))...((((.(((..........))).))))..,{(((.{{(({.(({{{((......))))))))),}}||,({(.(((((......(((((((((((.,..{{,....,,,,}})).......},,}....(((((((.....)))))))))))))).,}.)))))})...,}||{,,.({{.......}))})}},.....))))))))))),),..)))))))))....((((((...............(((((((((......))))))))))))))).,))))))).))))))}}|||||}}....})}..,,,,|,|,.,,..)))}(((((.(((.(((((...))))))).).)))))..)))))))).})))))}{({.(((((({.(((((((,,.((,,,..((({(((((,,((,((((((((((((((.(((..((((,{((({.(((((((..((((..((((((((((......)))))))(((((({.{(........}}...(((((((.(((((.,....,,..))))).)))))))))))))).)))..))))...)))))))}))))))))...)))))).))},,.,,,,{,((((((....)))))){(((({...}))))|{((,..,,{|.|||,,,,}}|}.}}}}||||||||,|,,,,,},||||||}},},)))},..,..(((({....)))))...(((((......))))){{,,{||||,||{{{{..,,..,,,)))}})}}))).})),....{{{{{....)))))...}))))))).)))))}}}))).|{(((..((((((,.(((((((..{{{{{{..(((((((((((((({((((.(({{{.,...{(((((((((..((((((....((((.....))))..))))))(((((((........)))))))............{{{{.,,.(((((((((.....)))))))))..))}}..((((((.,.........))))))....))))))))))..,,|{{{{|,...,{{((((((((((((....)))))))))))).})}((((((({.......((((((((((((.....)))))}.,)))))).,,,,,.))).)))))...|{{.....}}}..,,,,..{{{{{{{,|,..{{{{....))))|||{((((((((.,.,,,|((|..........,,,......{{{{{.....,,,..))))),,,,.{{{{......}}}}.}))))))))},|({.,.(((((((....))))))).|||,{{{{......,||||}})))|.{|||{,....,..(((((((((((.((.((({....)))).)).))))))))))),,,,,.((((((((((((((((({((((...((((.((((((((.,((((((..(((((((((((((((((((((((.{((,,(((((((((.((((..((((....(((((((..{(((((.(((((.(((.(((...(({.{({,,.....,))).))).))).)))..((((((((((((.((((...,,(((((......(((((((((((((......,(((((..,.,.,,..........}))))|...,,((((....{((((({...)))))))..}))}...........((((..(((((,{((((((.((((((((.{(((((((.(((.((((((......,,{...,|,,}}}.,))))))))).)))))))}.)))))))}..,.)))))))))))))))).{{{{(((((((......)))))))..,.,,,,..,..,}}}....,,.))))))))))},)).....))))),...........((((({....(({{...(((((...))))).})}),)))))))))).))))))))))))..(((.,,.....}}.))).})))))))))|(((((((..........))))).))......)))))))))))..)))).))),,..}}}}}},|,...{(((((,.,..,,,,,}}}}}}..{{{{..,{{{{.}},,.}}}}|{{{{{{{{,....||(,{{,,.}},.(((((((............(((((((((((((,((((({...}))))).,,,},}.}})))).)))))...,........)))))))......,}}||,...(({(((...}}}})}...|}}}}))))}}},....,{{,{{{{(,,,,,.,|||||,}}{((((.((((((({((,{{{,.,{{{{{,|,,...((((((.......))))))..,,,},,,,|||||{(((((..{((((((..{{{...........},}.))))))))))))))})}...(((({...}))))..{((((((..((((((..((.((...)).))..))).)))..))))))}}..,||||||||},,},)})))))))})).)))))))))))))).........))))))))))))))......)))))),....)))))...))).).)))...)))))))))))))))))))))....,|||}},....,}}},))))).)))))},,.........,{(((((((............}))))))),....((((((....,,,|||}}|..}}}}}))}..})))))||}},.|{{{{(,..}}}}}}}}}..,,,,},,}},,.)))))))}.))))))..)))}},{{...(((((((((.(((((((((((((((...((((({{((((((,{{{{.,,,,,,.,,..,{,,..(((((.((((((.......)))))).))))}{||}}..,....|||,,((((((,((({(,,{.......(((((........(((((...)))))))))){{({...(((((((.(((((..(((((((({{{((((((.{(,....})}.)))))))||(((((....))))).}},..(((((({{(...))),.}))))).,.,)))))))....)))))))))))).|,|}|||,,|||}},}}}}}}((.,..(((....)))....))...(((((........))))}((((((.......))))))(((((((.{....}))))))).........,....{(({((((((((({{((((,((,..,{{,{,||{|||{{{{{{((((.{((((({,,{.....||(({,{{{{.((((((,,,.....}}}}||.||.}}}}}}.}}}}}}}.)))))))))|}((((.((....)).))))...|||||}}},,))))),,))}})}.}}}}}}}}}}.}},}}}})))}}|||||||||}},,,....,,......,(((((...((((((((((((.((((((..{(({.(((((({...,{,.,.,|||,..((((..(((((...(((.....)))....({(,({{{..,,{{(,,...}}}....))))))}.......)))))..)))),,....,{(((((....)))))))||||}.|{{..,|...,,...,{{{,|..((((((((.....,((({..{{{((....((((((..((((...(((({...)))))........,,,((({(........)))))........................(((((.((((.(((........))).)))).)))))...))))..))))))....))}.}}}}}}},,((((........)))).((((..((...((((..(((((((.(((((((((.(((.((.......))))).))))..)))))...))))))).)))).))..)))))))))))),,}))}}},{(((((((......((......))...,..)))))))}..))))))).)))}.)))))).)))....))))))))))))))|||}}||}},}}..,,),)).}},}}|||}}}}},,||||||{||||(((({......))))}.,{{{(((.{{.((....,,}).)}))),)))},}})},,,,),},.}}.)})))))))))).))))))))..,|,{{{.{{{{(((({........)))))..)))}.))){(((((((((((.{{((((((((,..,,.((((((((.(((((((.((((((((((((((((((((.((((.....(((((,{...............................))))).....)))).)))))))((({....))))...))))))))))))).,,,.,,{{{{{}},..||||}|||(({{{.,{{{({....((((((((((((.,(({....})||((((.((({.{{(((........))))}(((((((((.....{,((((....(((((((.........)))))))....))))....))))))))).....}})).)))}}....{,{{..,,,|,,||}}..}}}}......))))))))))))..,,,}},,{,,((((((({,,,.((.(((((.(.({.(((((....}))))}).}))))))}|.}}},..}))}}}..||||}|||||......{{{{,,........,,|{((((....)))))}.,},,}}))},}.....|{|||||,,,..|||||},,})),)))},,,,...)))))))))))))))...,,...........}}))))))....}}.)))))))))))}....))))))).)))))))))..,,}}...)))))))..))))))}.}},....})).}),))}|.,|}}|,..}))))).......})}))))),}}}}}))}},.,,}}})})),))),},..}},((((((((.((((({...})))))...))))))))}}.}}}}})))))))))).})))}.|,,.(((.({.(({{{.({.{(({.(((((...))))).............,{{.((((..((((((({..{,{{,...,|||,,,{..{{{{{||||,|{({,{,{{,....(((((({....))))))).,,,}}.,}.,,}))))}}})}})}.(((((((((.....))))))))).....(((((......,))))){{{{{{{{.{,||...}}}},,,||{|{{(,,{{{..,}}},.}}))))},,,|,{{{....{(((.....))))..}}},{{{.,,...,||}|(((((((((...((((((((..,,.(((((((..{{.{,,{{.,{(((({........)))))}}.))..))))))).,....((((({,(((..(....)..))))))))).{(((((((....)))))))}..))))))))...)))))))))},,.,{{,|||.,,|||.,...,,.,,,.}}}}}},}},|{{||||{{|{({..((((((((((((........))))))))))))..}}((((((.((((((((((..((((((,,((..((((({(..,,,...,((..((((((((..........)))))))).}}...|||,,||,,,{((..((..((((((.........{,....,}.........))))))..))..)))..........,,((((({,,,.,,||}}}},{{{{{||||||||||}||,{(((((((..{{(((....}}}}|....}}))}}}...,,..,,,.,,}|}}}|,},)}))}},},..,|}}||||}.,,((({,,,,.,|{{{{{,,........,.......,,}},,..,,,...}}))))))}))},,}}}},,.....,,}}.)))))..))))))))).))))))))))..))))))..||||...((((...))))..}}},,))))}})}}}}...)})}}..,)))}))))},.))))))))..))))..,,.(((((((..........))))))),},)))).}},))))))},))}.......)))))))).............,..))))))))).

Transcripts

ID Sequence Length GC content
GCUGCGCUCCACCCCAGUGGCUGGAGGAGCAGCUCUCCAGUCAGCCUUU… 7270 nt 0.3630
Summary

The protein encoded by this gene is a member of the Sprouty family of proteins and is phosphorylated by tyrosine kinase in response to several growth factors. The encoded protein can act as a homodimer or as a heterodimer with SPRED2 to regulate activation of the MAP kinase cascade. Defects in this gene are a cause of neurofibromatosis type 1-like syndrome (NFLS). [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that exosomes derived from hypoxic mesenchymal stem cells (Hypo-Exos) significantly promoted bone fracture healing by enhancing angiogenesis, endothelial cell proliferation, and migration compared to normoxic exosomes [Liu et al. DOI:10.1016/j.actbio.2019.12.020]. In a rat model of pulmonary arterial hypertension-induced right ventricular failure, transcriptomic analysis identified the SPRED1 as a gene whose epigenetic downregulation is associated with increased angiogenesis and improved right ventricular function [Potus et al. DOI:10.3390/ijms19092730].