| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAACCCCUGGUACCUGAGCACUGAUCUGCCUUGGAGAACCUGAUCCUGA… | 677 nt | 0.5214 |
Enables lipid binding activity. Involved in antibacterial humoral response and defense response to Gram-positive bacterium. Located in cytoplasm. Is active in extracellular region and secretory granule. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the SPRR2A is a general mucosa mRNA marker used in multiplex endpoint PCR assays for forensic body fluid identification, showing high expression in tongue and cross-reactivity with skin and mucous membranes [Lindenbergh et al. DOI:10.1016/J.Fsigen.2012.01.009]. Subsequent research on palmar hand and finger surfaces from 60 individuals found the SPRR2A was used in mRNA profiling to detect mucosa, with its co-expression alongside skin markers being frequently observed in these touch DNA samples [Lacerenza et al. DOI:10.1016/j.fsigen.2016.01.012]. A preliminary study evaluating mRNA markers for saliva identification in humans found that the SPRR2A was not specific [Haas et al. DOI:10.1016/j.fsigen.2012.10.011].