| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGUCUUCUAAAGAUAAUGUCGAUUGUGUAUGGCUGAUGGGAUUCUAGG… | 8018 nt | 0.4733 |
This gene encodes a member of a family of molecular scaffold proteins that link the plasma membrane to the actin cytoskeleton and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms a component of the erythrocyte plasma membrane. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis-2, pyropoikilocytosis, and spherocytosis, type 3. [provided by RefSeq, Aug 2017]
A review of forensic proteomics literature identifies the SPTA1 as a protein marker used in combination with other markers for accurate peripheral blood identification in human samples [Shirin Alex et al. DOI:10.1016/j.scijus.2025.101320]. A review of forensic proteomics literature identifies the SPTA1 as a protein marker used in combination with other markers for accurate peripheral blood identification in human samples [Alex et al. DOI:10.1016/j.scijus.2025.101320].