Basic Information

Symbol
SPTA1
RNA class
mRNA
Alias
Spectrin Alpha, Erythrocytic 1 EL2 Spectrin Alpha Chain, Erythrocytic 1 Erythroid Alpha-Spectrin Elliptocytosis 2 SPTA Spectrin, Alpha, Erythrocytic 1 (Elliptocytosis 2) Spectrin Alpha Chain, Erythrocyte Alpha-I Spectrin SPH3 HPP HS3
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_003126.4
Sequence length
8018.0 nt
GC content
0.4733

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2560.20 kcal/mol
Thermodynamic ensemble
Free energy: -2697.38 kcal/mol
Frequency: 0.0000
Diversity: 2247.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((..(((((((((((....((((.(((.....((((....((((((........))))))......))))))).)))).....(((((((((((((......(((((((.((((....)))).))))))).(((((((((((((...(((((....((((((.(((((..(((((...))))).)))))))))))..((..(((((((((....(((((((.....)))))))........)))))))))..))...)))))....))))))(((((.........(((((((.(.((..........))).)))))))((((......))))..(((((((((((..((.....))..)))))))))))..)))))..((((((((......))))))))))))))).(((...(((((.....)))))....)))...(((............)))))))))).)))))).....(((((((..(((....)))........(((.(((....))))))...........)))))))...((....((((((((.((.((((((((.(((((((....((((((((..((..(.((...)))..))))))).)))(((.....)))..(((((.....))))).(((((((((((.((((.(((...((((((((((..(((((....)))))..)).(((....((((((((........((((((.(((((((....(((((((.....(((((.((((((..((((.(((.(((((((............(((((((((((((.(((..((((((.(((((((..((((((((((((.........((((((((((((.(((.((((......))))((((....(((..((((.(((........(((((((..(((.(((((((((((((.....)))...)))).)))).((((((....))))))....)).)))..........((((((....(((((.(.......))))))..)))))).(((........)))((.((((....)))).))...(((((........)))))(((((((((((.((((((.(((((....(((.(((((....)))))..)))....)))))...)))))).)))...(((....(((......)))..)))........))))))))..)))))))........)))))))..)))....))))....((((((.((((....)))))))))).....((((..........)))).)))))))))))))))......((((((((((........((((((((((((((..((((..(((..((((..(((......((((((((..((((((.((((....(((........))))))).))).))).))))))))......)))..)).))..)))((((((((((((.(((((.((....))))))).)))))).....)))))).......))))..))))..))).).)))))).....))))))))))))))..)))))))).((((..(((.(((.(((.....(((((......))))).((((..(((((((((((..(((((((((((((.(((.....(((((((((((....((((((.(((((((.....((((((((((((.........)))))))).((..(((((((((...((((..((((((((((..(.....)..)))))))))).)))))))))))))..))....((((((((.(((((......)))))...........((((....)))))))))))).....((((((..(((.((((....((((((...))))))...)))))))((((((.....((...)).....)))))).((((((((((((((....((((((((.....)))).))))(((((((((..........((.(((((..............(((((...((((....))))((((..(.....)..))))...(((.(((((....(((.((((.(((((...))))).)).)).))).....))))).)))..........(((....))))))))....))))).))(((((((((..((.......))..))))))))))))))))))...(((....(((((((((((............((((((...(((..(((((((((((((.((((.((((.(((((.(((((((((((.........))))....))))))))))))((((.(((((((.((((((..(((...(((.(......).))).((((((..((((((((.............(((..((.((((((((...(((..(((((.((((..(((((...(((((((((((((((((((...(((((...((((((...)))))))))))..)))....)))))))))...((((.(.((((....)))).).)))).....((((.((((..(((((..((..............))..))))))))).)))).)))))))...)))))..))))...)))))..))).))))))))))..)))(((((.((((....)))))).))).....))))))))..))).))).....((((((....((((((.((..(((((((..(((((((((((..(.((((((........((.(.(.(((...........))).))))........)))))).)((((....))))((((((.....)))))))))))))))((((..((((..((.((.(((((((...))))))).))(((((((..(((..(((.......)))..)))...(((((((((..((((..(((((((...((((.....))))...((((..((....((((((..((((..(((.....))).......(.((((........)))).)))))..))))))...))..))))((((.(((((....(((((...((((((((....))).)))))..((((((((...(((((....)))))((((((((..(..((((...))))....)..))))))))........((((((((......))))))))(((((((((((((....((((.((((((.........)))))).))))...)))))((((((((((......(..(((((((..(((((...)))))..)))))))..)..((((.(.(((((((..(((((....))))).....(((((.((((......(((.((((.(((.(..((((((((...((((((((.(.((..((((((((.(((((.....)))).).)))))((((((((((.(...........(((.(((.((((.((((..(((..((((((....))))))....)))..)))).))))))))))...).)))))))))).......(((......)))...)))..)).).)))))))).((((((.((..((....))..))))))))........((((...((....(((....)))...))...))))...(((((........)))))((((((....(((((......)))))....))))))(((((.(((((...))))).))))).(((((((((((....))))))).))))..(((((((...(((((...))))).)))))))...((((((.....))))))...(((((....(((((((((..((......((((((..((((....)).))..)))))))).))))))))).)))))..)))))))).))).).)).)).)))........)))).))))).(((((((.................))))))))))))))...(((((((((((.(((.......)))..)))))))...)))).).))))....))))))))))..).)))))))......)))))))).........)))))....)))))))))...(((((..(((.........)))..)))))....)))))))...)))).)))))))))..((((((((..(((((((((.(((((((((...(((((((..........)))).)))...(((((.((......)).)))))((.(((((....)))))..)).(((((((.((..((((((((((...((((((((..(((........((((....((((.........)))).....))))........((((((((.((...(((((.........))))).)).))))))))......))).)))).)))).....)).))))))))..((((((((((((((((((((((.((((((((...))))...)))).))).)).....)))))))(((((((.((((.....(((((..(.((((...((.((((((.....(((.((...)).)))...))))))..)))))))..))))).....).)))))))))).))))).))))))).))))))).))).))))))..)))))))))..))......)))))))))))))..((.(((.....))).)).....((((((((...........)))).)))))).)))).))))))..))))))).............(((....)))..)).))))))))))))...((((..((.(.(.((((....)))).).).))..))))......))))))))))))))))..(((.....)))......)))).....(((((.((..((((.....)))).....)).))))))))).))))))).)))))....)))))..)))..))))))((((((((((((.........)))))....((((..(((..((.((((......(((((((.((.(((..(((..(.......)..)))..))).))..)))))))....)))).))...)))..))))..)))))))..((((((((...)))))))))))))))))))...)))....((((((.(((....))))))))).)))))..))))))))).....((.(((....(((....)))....)))))...))))))((.((..(((......)))..)).))..........)))).....)))))))))))))((((((((((((((((((...(((((...........))))))))))).(((.(((((((..(((.((((((((((((((((((.((...............(((((....)))))...(((((((((((....(((((...((.((...((((......))))....)).)).........((((((......))))))...(((((((.(((((...))))).))))))).((......))))))))))))))))))((.(((((.((((((((((((((......)))))..))))))...((((.........)))))))))))).))...((....)).))))))))).)).)))))).))).))).))))))).)))....((((((((....)))....)))))..))))))))..)))).....)))))))...))))........))).)))))))....((((((.((....((((....))))...))))))))......((((((.........)).))))((((((((((((.....))))...)))))))).....(((......))).)))))).))))))))....)))..))))...((((.......)))).........))).))).)))..)))).......((((.(((((........)))))))))............))))))).)))))).))).....)))))))))))))..(((((.....)))))..(((((((((........)))))))))((...((((..(((((((.....((....))....)))))))....))))....))...))))))).)))))))..)))).)).)))))(((((...((((....))))..))))).......(((((((........)))))))...(((((((.((.((....)).))...))))))).))))..)))..(((((((..(((......((((((......)))))))))..)).))))).....)))))))..))))))..))))))))....)))...))))))))...)))..))))...)))((((((((((.(((..(.(((.......))))..)))))))))))))...)))))))).((((((((...........(((.(((..(((((...((((.....(((.(((((..(((.((....)).))).......((((.((....)))))).((((((..(((((.(((((((.......))))))).))))))).))))(((((....((.((((((...(((((((((((((....(((.....)))..)))).))))).))))))))))..))....)))))...))))).))).))))..)))))..))))))...((((((((((((((((.((((((((((((.((.(.((((.((((((.(((((((((.....((((((((((((((.((((((...))))))))..(((((((((((..(((((((.................(((((.((((..(((....(........)....)))...))))))))))))))))..))))......(((((.((((...((....)))))))))))......((((.((((((((........(((((((((..(((.(..(((((...((((.((..((((((((.((((((((((....)))))....((((((........)))))))))))..((((((((.(((..((..(((....(((((....))))).....)))))..)))))))))))...........(((((...(((((.....)))))..((((((.......))))))...........))))).))))))))..))...........))))...)))))..).)))))).))))))((((((.((((((.....((((.((((((((((.((.....(((..(((((........))))).)))......))...)))))))).)).))))......))))))..(((((.....))))).................(((((((((...((.((........))...))..))))).))))((((((((((((((((((((((((((.((.(((((((((..(((((......)))))....(((((((.((((..((((........)))).............((((((((......(((((...(((((......)))))..))))))))))))).........)))).)))))))...........))))))))).)).))))))).))).)))))))))))).)))).(((((......))))).((((.....)))))))))).........)))))))).)))).))))))).........)))))))))).))..)).)))))))...)))......))).)))).).)).)))))))))..........))).)))))))))).).)))))......(((((((((((........))))))))))).))))))))......))))))))))).......((((((((((((((.(((((......))))).)).(((((......)))))..))))..))))))))....)))))).))))))))..)).....................(((((((((.......(((((((..........)))))))......)))))))))...))))))..)))))..))))).
Thermodynamic Ensemble Prediction
...((((({,,{,{,(({((,.,|{({((.(({,,{,,((({....{{((((........))))}|,,,,,,|}|||||||}}|,,.,|||{||,.,,,{{{,.....(((((((.((((....)))).)))))))...{(((((((({(((((({(((...,(((((.((((({.,{{(({{{{||||{|,||,,,,,||,,,...,{||||..,,...(((((((.....))))))).}}}}}))}))))))}.,.))))).))))}.,}))))))|{{{,.,...,|||{{(((((.(,{{,,..,,,,...,}.}|||||||{|||,,|||||,,..(((((((((((..((.....))..))))))))))),,}}},,..((((((((......))))))))..{{{{((((({((((((......,,.,,,,,.,...}.|||..,,..,,{{{{|,|{{{{{{{,((((((.{{{{(((((({..(((,.,,||}........((,{(((....))))))..,,.......))}}|},{(((.((((({...}))))).)))}{|||.(({{{{,....(((((({{,,{(.{(.((...))}.,))))))).)))(((.....))),.(((((.....))))).{{||||(((((.((((.{{{...((((((((((.,(((((....)))))..}},{({,,..{(((((((......,,({((((.(((({{(,,..(({((((,.{{,({{{{.{(((({..({{({({{,{(({({{.......,{{..{{{(((({{{{|{.||{..|{||{{.{{{{(({,.({((((((.,((,.......,|{{||||||{|{,{||.((((......)))){{{{....|||..||||,|||,.......{((((((..{((.{{(((((((((((.....)))...)))).)))).((((((....))))))....}}.}},..........((((((....(((((.{......,})))))..)))))).{((........))){|.{{{|..,,}}}}.,}...(((((........)))))(((((((((((.((((((.(((((..,.(((.{((((....))))}..))).,..)))))...)))))).))}...{((,...{{|,.....)))..)}).,,....,)))))))).,))))))}......{{||||,},..},,.,,,})))||..((((((.((((....)))))))))).....((((..........)))).))||}||}}}}))}}.,,...((((((((((...{{{..((((((((((((((..((((..(((..((((..(((......((((((((..((((((.((((....,((.....,,.}},)))).))).))).))))))))......)))..)).))..)))((((((((((((.(((({,((....))))))).)))))).....)))))).......))))..))))}.,)).),}))))),}},.)))))))))),},},.}}}|||||({{(,(({(((((,{.((((((((((,,..}}}.))),)}}}.}.}}}}),||{,,,,|{{||,{(((({{|.{||...,,||{{{{{{{{|..|,||||{|,|{|||{{.....{{{{{(((({({.......,.})))))},.((,.((((((((({..((((..((((((((((.,(.....).,)))))))))).)))))))))))))..}).,..{{{(({{,.(((((......))))),,{,,.....,||||....}}},}}}}}}}||,{..{{{{{{..(((.((((.{..((((((...)))))).}})))))))((((((.....((...))..,..)))))).,{(({({{(|{{{{..||||||||{{....,}))},}}}},|||||{|||}}}..,,,,(({(({((,{...........,|||{(,,.{{,{....}}},((((..{.....}..))))...(((.(((({....{{(.((((.(((((...,}))).}||||.}}|.....})))).))|,.........|||....))))}|||....,,,}}.,|(((((((((..({.......}}..))))))))))))))},|},.,{{|||||(((((({{{{|,,.,,,,,,...((((((...{{,..(((((((((((((.((((.((((.(((((.((((((({((..............,}}.))))))))))))((((.(((((((,{(((((..(((.,,{,{,(,{,,,.,,||,.((((((..((((((((..{.......|,.(((..((.((((((((...(((..(((((.((((..(((((...(((((((((((((((((((...(((((...((((((...)))))))))))..)))....))))))))}...((((.(.((((....)))).).)))).....((((.((({..(((((..((..............))..))))))))).)))),)))))))...)))))..))))...)))))..))).))))))))))..))),{|{{.((((....)))))).}}}.....))))))))..))).)))..,,.((({{,...,((((((.{,..((((({{.,((,((((((((..{.{{{{{{{{{{(,..((.,,(.({{.,,,{{,..,,|,,{{{|{..,{{...,,||((.|((((....)))){||||,.....))),,))))),||||(({...,||},.||.{{.,{(((((...))))))|,||{(((((({.(((..(((.......)))..)))...(((((((((..((((..(((((((...((((.....))))...((((..((....((((((..((({..((({......}}}.},,,|,((((........)))).))))).,))))))...))..))))((({{(((((.{..(((({...{(((((((....))).))))).{((((((((...(((((....)))))((((((((..(..((((...))))....)..))))))))........,{((((((......)))))))|(((((((,(((((....((((.((((((.,.......)))))).))))...)))))((((((((((......{..(((((((..(((((...}})))..})))))|,,|.{{(((,{.(((((({..(((({....)}))|{{,..{((,((({((...{(((((,.,{{{((,.{..{,,(((((...((((((((.(.((..(({(((((.(((((.....)))).).)))))((((((((((.(...........(((.(((.((((.{(((..(((..((((((....))))))....)))..)))}.))))))))))...).)))))))))).......(((......)))...)))..)).).)))))))).((((((.((,,,....,))..}}))))))....|,,.{{{,,,.{|...,(((,{{.||}..{||{,.|||,...(((((.,....,.))))),{{(({.,..(((((......)))))...,))))}|(((((.((({|...})))).))))),||||(((((({....))))))).}}}|,,(((({|{||,,{{||,,,))))}.))))))}...((((((.....)))))}...||{{{....({((((((({,,.......{((({(..{{({,,.,}),}}..)))))))),},}}}|||}.}}}||||||}|||||,||}.,,}),||{||}|{|,....})),)))))).||{{|||,,}....}}.,,}}}}.}))))}}})))))).,.({(((((((((.((|.,.....))),,)))))))..,))))...}})},...))))))))))..|.)))))))}.....)))))}}}|}.......)))))..,.)))))))))...{((((..(((.........)))..)))))....)))))))...)))).))))))))},}||||||||}}|||||||||.{{{|{{{{{,,|||||{{{..,.,,,..,||||.||{.,,{(((||{|,.}}..},}),|||((.(({((,,..},}}}.}))}|,|||||},,.,{((((((((({..{(({((((,{{{{....{{{.({{{,{{{(({(,,,.,.,,,||}|,.,..||||........{{(|((((.,{.,,||,||,.,......}})||,}}.}}}|||}|.....,,)),)}}}.)))),..,|}}|,|||||||..{{,,{,||||||||,{,|||||.{||||,|}.}}.)))}},))))}))}.}),,...})))}|}(((((((.(((,.....(((((..(.((((..,(,.((((((.,.,{{,..{{...}}.))),..))))))..)))))))..))))).....,.)))))))))).},,}}}}}|||||{|||||||,||,,}))))}..,}}}}|||,..|,,,....,}))}}}})))||{.,(.(((.....))).))))},}||||||{,,||,...,}}.}))}.)))},,....,}}}}|}},,)}})))).............{{|.,.,)),,,)).)))})))))))),,}(({{,,((.{.{.{(((....)))),).).))..))))......))))))))))))))))..{((.....))),.....)))).....(((((.((.,((((.....)))}}}...)).))))))))).))))))),}))))....)))))..}}}..))))))((((((((((((.........)))))....((((..(((..((.((((..,...(((((((.((.(((.,(((..,.......,..)})..))).))..)))))))...})))).))...)))..))))..)))))))..((((((({...))))))))))))))))))).,.},}.{{.((((((.(((....))))))))).))|||.,))))}}}||,...{((.(((.,,.(((....))).}}.))),},|.}}}}}},{|{{,,(((......)))..}}.}},,....,...)))).....}})}))))))))){(({{{{{{{{{((((((...((({(...........))}}))))))).{{{,||{{|||..{{{,|{||{{{{{{||{|{{{||.,..........,|,..(((((....))))).,)}|||||{{((((((((((.........}}.,))))))}...}})},,..}},}},},,}}...((((((......))))))...(((((((.(((((...))))).))))))).||.....|}||}}}})))))}|||}|((.(({||.|{{(((((((((((......)))))..))))))...{(((.........)))))))))))),}),,,||....)).,})))))))},|,|||}}}.}}}.))).})))))).)))....{{{||{{|,...)))....)))))..})))))))..||||,,|,.}}}}|}}...||}}.,....,,))).)))))))||||({{{{{,{,....{{{{....))))}}},))))}||.{(,,{(((,,,,,.|||{,,|}{||..,{{{|||{{||||,}|,||,,....|((((({,...{{{{(((,({{{((,((.{{(((..{((({...,{{.}}}}).}.{(((,..,,,,}|}}......)),))}.},||||||||}||,...,,.|},,.}}}))))}....,}}}||}|||,,......,,,.))))))).))))}}.}))..,,,||||}}|||||||{||{(((.....}}}||..(((((((((........)))))))))||,,.((((..(((((((.....((....))....)))))))....))))....||..,||}}}})}))))))),})))).||,|||||(((((...((({....})))..)))))}...,..{(((((({,,.,.,.}||}}}}...(((((((.((.((....)).))...))))))).||||,,||,..(((((((..(((......((((((......)))))))))..)).)))))...,.))))))},,|||||}.,||}|||||.,,,||..,,}||||}}}...))),.}|||,..}}}{{{{{{{{{{.{||,,|.|||,,...,,)}),..)))))))))))))...}))))))}.({((((((,{.,,,.....(((.(((..(((((.,.((((..,({{{(.(((({..,{{{({.,.,||,|||,{.({..,,||.|}}}},|||||}.(((({{,.{((((.(((((((.......))))))).)))))}}.))))(((({...,{|,((((((...(((((((((((((.,,.(((.....))),,)))).)))))))})))))))}..))..,,)))))...))))),))),)))),.)))))..)))))},,,(({{{,((((((((({.((((((((((((.((.(.((((.((((((.(((((((((...{.(((((((((((({{.((((((...))))))}}..(((((((((((..(((((((,................((((,,((((..(((....{........}....)))...))))))))))))))))..))))......(((((.((((...((...,).)))))))))......((((.((((((((,,.(((((((((((((({{((({(({((({.,{{((({{(,,{((((,(((,((((((((((....)))))....((((((........)))))),||||..((((((((((((..{(..{((....(((((....))))).....)))})..)))))))))))....,}}}.((((((.,..(((((.....)))))..})))))).,{,,{,}}.||||.......{{{,|||,}}})))}).,)}.......}}}))))},}})},,,...{{(((((((.|...}.))))))))}||,||||||{{,||||||||{{,{,.....(((..(((((........))))).)))......,,..,)))))))}.,,.,}|},,,,{{||||}}..((,(({{..{|||||..,{{{{...,,......,||,|,|}},.,|.,)))))}...)))).)).,)})})})))),}|{((((((((((((,{,(((((((.((.((((((((({.(((((......})))}....(({{{({,((({,.{{{{,,,,.,,.|||},..,,........(((((((({{{{{{.{{{,...{,{{,,,.},.))}))..))))),)))))))....,,,..,)}).})}))))..........,))))))))).)).))))))),},))))))))))))}).)))),}))))))),}},.....((((.....))))|{||........}},)))))))).)))).))))))).........)))))))))).))..)),)))))))...)))......))).)))).).)).)))))))))..........))).}))))))))).).)))))......(((((((((((........))))))))))).)))))}},......))))))))}))..............,}))))))})))}}}))}))}}},,||||{{{{.....,)))))}))))}},...,,.,|,,,.,...)}|||,|||.}|,,||,,....},...}))),))).{{((((({{..,,,,.{((((((........,.))))))}...,..}))))))}).))}))))))})))))))))))).

Transcripts

ID Sequence Length GC content
AUGUCUUCUAAAGAUAAUGUCGAUUGUGUAUGGCUGAUGGGAUUCUAGG… 8018 nt 0.4733
Summary

This gene encodes a member of a family of molecular scaffold proteins that link the plasma membrane to the actin cytoskeleton and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms a component of the erythrocyte plasma membrane. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis-2, pyropoikilocytosis, and spherocytosis, type 3. [provided by RefSeq, Aug 2017]

Forensic Context

A review of forensic proteomics literature identifies the SPTA1 as a protein marker used in combination with other markers for accurate peripheral blood identification in human samples [Shirin Alex et al. DOI:10.1016/j.scijus.2025.101320]. A review of forensic proteomics literature identifies the SPTA1 as a protein marker used in combination with other markers for accurate peripheral blood identification in human samples [Alex et al. DOI:10.1016/j.scijus.2025.101320].