Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCAGAUUCUCAAUCUUGCUUGAAGACUGACAAGAUGUCCCUGUGGACU… | 2280 nt | 0.3662 |
Summary
The protein encoded by this gene is a hormone involved in modulation of cardiovascular and renal function. It has also been shown in rats to cause weight loss. Several transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]
Forensic Context
A study in humans demonstrated that the SPX is part of a 38-gene transcriptomic signature of obesity, showing a negative coefficient of -0.126 in subcutaneous adipose tissue, and this signature strongly correlated with body mass index (R = 0.63, p = 2.87 × 10−71) and fat mass (R = 0.61, p = 6.46 × 10−66) across 626 samples [Francesc Font-Clos et al. DOI:10.1088/1361-6579/aab85a]. A study in humans demonstrated that the SPX gene, associated with long-chain fatty acid import and negative regulation of appetite, was downregulated in the subcutaneous adipose tissue of heavier monozygotic co-twins compared to their leaner siblings within BMI-discordant pairs [Muniandy et al. DOI:10.1038/ijo.2017.95].