Basic Information

Symbol
SRA1
RNA class
mRNA
Alias
Steroid Receptor RNA Activator 1 STRAA1 SRA Steroid Receptor RNA Activator Protein LncRNA SRA SRAP Steroid Receptor RNA Activator 1 (Complexes With NCOA1) Steriod Receptor RNA Activator 1 Steroid Receptor Coactivator Pp7684
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_001035235.4
Sequence length
1328.0 nt
GC content
0.5369

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-457.90 kcal/mol
Thermodynamic ensemble
Free energy: -480.32 kcal/mol
Frequency: 0.0000
Diversity: 425.31
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.....)))((((((((....((((((((((.((.....(((.((((....((((((((((.((.....)).))))).))))).....((..((((((.(((.(((((((((((..(((((((.((........)).))).))))....((((((((((.....)))((((((........).))))).))))))).((((((((.((((((((......((((.....)))).....))).)))))..)).)))))).))))).)))...))).)))....(((((((....((((((((...((.((((.((.((.((((..(((....((...))....(((((((((((.(((((..((((.(((......((((((((.(((((((.((((((.((.((((.((....))))))....)).))))))......)))))))))))))))...............((((((((((.....(((....))))))))))))).(((((.(((((.........((((((((.((((...(((.(((..((.((.(((((.((((.((((.(.((((((....)))))).).(((((.((....)).))))).(((((((.(((((((((..((((...((.((((...((((.((((..((...........)))))))))).)))).))........((((((...........))).))).(((((........)))))..)))).))).)))))).)))))))))))))))...))))).))))..((((((..(((........))).))..))))))).))))))))))))))).(((((..........)))))..............)))))))))))))))))...)))))............))))))))))).)))..)))))))))))).))))))))))....)))...))))..))))))..)).......((((((((..........))))))))..)))).)))...))))).)).)))))..)))))))).................((((((...))))))(((.(.(((((...(((((((..((((....(((....((((......))))....))).((((((....))))))...((((((((.......)))).))))....(((((........))))).....(((((.(((..(...((((.....))))..)..))).)))))......((((...((..((.((((.....)))).))..))....))))))))..)))))))..))))).)))).
Thermodynamic Ensemble Prediction
,{(,,,,.|||((((((((....((((((((((.((.....(((.((((....((((((((((.((.....}),))))).))))).....(({,(((({,.{((((,,((((({{(..(((({((.{(...,.,,.}}.|||.}}|},,,,((((((({((.....)}}((((({,,......}.))))}.))))))).((((((((.{(((((((......((({.....}))).....))),)))})..)).)))))).))))).)|||}}))}|})||||}},,..,,,,,.((((({{{...((,{(({.{{.((,(({(.,{{{....||,,,}}..,,(((({({{{{{.{||((,,({{{.(((..,,..((((((((.(((((((.((((((.((,((({{({....}}))))..,.)).)))))}......)))))))))))))))......,.,.....}|||||{((((,..,||||.}}..))))))||||||.(((((.{({({...,,..,.||(((((({((({...{{{.{{{..{{.((.(((((.((((.(((({(.((((({....}))))).).(((((.((....)).))))).{((((((.(((((((((,,(({,...((.((((...((((.((((..{{...........)))))))))).)))).)).......,((((({...,....,,,))}.}}}.(((((........)))))..}))).))).)))))).)))))))))))))))...))))).)))),|{{{,,|..|||,,,,,,},))),....})))))},}))))))))))|}||.{{(((,,{,....,,))))}.,............}}))))))))))))))).,,))}}),..........}))))))))))).}))..)))))))))))),))})))))))}})}))}.)}))}),.}}}}}}..,},,}||..((((((((..........)))))))).,}))).)))..,}|}}}.}}.)))})..}}))))},.}}|...,,,,......((((({...})))))||||||{(((({..(((((((..((({..,{{{{|,..{({{..,,,.}}}}..,.|,,.((((({....}))))}...,,.,,(({...,{,{||||.}}}}.,,,{{{{{........)))}}...,,{((((.(((..{,..((((.....))))..),.))).))))}.,{...{|{|...,,..{(,{,{,.},,.)}}}.))},)),,..}))))}))..)))))))..},)))))}},.

Transcripts

ID Sequence Length GC content
GCUGGCCAAGCGGAAGUGGAGAUGGCGGAGCUGUACGUGAAGCCGGGCA… 1328 nt 0.5369
GCUGGCCAAGCGGAAGUGGAGAUGGCGGAGCUGUACGUGAAGCCGGGUG… 1280 nt 0.5406
Summary

Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]

Forensic Context

A study in rats demonstrated that the SRA1 was significantly altered in expression on day 4 following a 20% total body surface area burn injury, as part of a comprehensive analysis of hepatic gene expression changes [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. A review of long non-coding RNAs in mammals and other eukaryotes, including human, mouse, Drosophila species, and yeast, synthesized findings on numerous transcripts, noting that the SRA1 was one of the first characterized long ncRNAs and was later found to also encode a protein that acts antagonistically to the function of the ncRNA [Mercer et al. DOI:10.1038/nrg2521].