| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGGGAGGGCAGCGGCCACCGGCGAGGAACACGGCGCGAUGCAGGUUCA… | 4519 nt | 0.4346 |
This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the SRD5A2 is expressed in specific fibroblast subclusters (FB1, FB4, and part of FB3) within the corpus cavernosum, with SRD5A2+ cells spatially located around the septum pectiniforme [Zhao et al. DOI:10.1038/s41467-022-31950-9].