| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUUCCGAGGAACUUUUCGCCGGCGCCGGGCCGCCUCUGAGGCCAGGG… | 4520 nt | 0.6288 | |
| AGUUUCCGAGGAACUUUUCGCCGGCGCCGGGCCGCCUCUGAGGCCAGGG… | 4469 nt | 0.6319 | |
| AGUUUCCGAGGAACUUUUCGCCGGCGCCGGGCCGCCUCUGAGGCCAGGG… | 4901 nt | 0.6321 |
This gene encodes a basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a motif that is found in the promoter of the low density lipoprotein receptor gene and other genes involved in sterol biosynthesis. The encoded protein is synthesized as a precursor that is initially attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription. This cleaveage is inhibited by sterols. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternative promoter usage and splicing result in multiple transcript variants, including SREBP-1a and SREBP-1c, which correspond to RefSeq transcript variants 2 and 3, respectively. [provided by RefSeq, Nov 2017]
A study in humans demonstrated that the SREBF1 mRNA exhibits rhythmic expression with peak levels between 9:00 h and 15:00 h, and its expression pattern was used alongside three other rhythmic mRNAs to construct a k-nearest neighbor regression model for estimating bloodstain deposition time within a 24-hour cycle, achieving a mean absolute error of 3.92 hours [Cheng et al. DOI:10.1016/J.Fsigen.2023.102910]. Separately, a bioinformatics analysis in humans identified the SREBF1 as a predicted transcriptional regulator of key hub proteins in cardiomyopathy, with receiver operating characteristic curve analysis showing an area under the curve of 0.925, indicating strong diagnostic potential [Rahman et al. DOI:10.1038/s41598-024-78011-3]. A study in mice and other models demonstrated that the SREBF1 is a transcription factor involved in lipid metabolism and adipogenesis, where ectopic expression alongside PPARγ can revert activated hepatic stellate cells to a quiescent state [Michalik, L.; Wahli, W. DOI:10.1172/JCI27958]. In a human forensic autopsy pilot study, RNA sequencing analysis of a fatal insulin overdose case identified the SREBF1 as an upregulated downstream effector within the activated insulin signaling pathway [Nakao, Naoki et al. DOI:10.1016/j.legalmed.2025.102772].