| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCUGUGCGGCGCCCGGGCGCAACGCAAACAUGGCGGCGGGUGGCAC… | 5237 nt | 0.5805 |
This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
A study in rats demonstrated that the SREBF2 (sterol regulatory element binding transcription factor 2) was identified as a potential RNA marker for methamphetamine reward and addiction through transcriptome profiling of whisker follicles, showing a constant-down regulated expression pattern (0.94 at MASA, 0.55 at WD) and ranking with a betweenness centrality score of 0.0211 [Song et al. DOI:10.1038/s41598-018-29772-1].