| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCAGCACCAGCGCCUGGGCUGGAGGACAGAGAAGCCUUUUCCGUUGCC… | 3812 nt | 0.3851 |
This gene encodes 54-kD nuclear protein that contains an arginine/serine-rich region similar to segments found in pre-mRNA splicing factors. Although the function of this protein is not yet known, structure and immunolocalization data suggest that it may play a role in pre-mRNA processing. Alternative splicing results in multiple transcript variants encoding different proteins. In addition, a pseudogene of this gene has been found on chromosome 12.[provided by RefSeq, Sep 2010]
A study in humans demonstrated that the SRSF11 exhibited a significantly decreasing expression trend from 0 to 7 days after severe burn injury in blood samples, identifying it as a temporal expression profile gene [Wu et al. DOI:10.1016/j.burns.2018.08.022]. In mice selectively bred for differential methamphetamine consumption risk, the SRSF11 was identified as a network hub node among ventral midbrain differentially expressed genes overexpressed in the low-drinking line, with connectivity differing by at least 0.5 [Hitzemann et al. DOI:10.3390/brainsci9070155].