Basic Information

Symbol
SRSF11
RNA class
mRNA
Alias
Serine And Arginine Rich Splicing Factor 11 P54 Splicing Factor, Arginine/Serine-Rich 11 Serine/Arginine-Rich Splicing Factor 11 SFRS11 NET2 Arginine-Rich 54 KDa Nuclear Protein SR Splicing Factor 11 Splicing Factor P54 DJ677H15.2
Location (GRCh38)
Forensic tag(s)
Wound age identification Drug abuse diagnoses

MANE select

Transcript ID
NM_001350605.2
Sequence length
3959.0 nt
GC content
0.3958

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1042.40 kcal/mol
Thermodynamic ensemble
Free energy: -1115.21 kcal/mol
Frequency: 0.0000
Diversity: 983.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((......(((((.(((.(((((((((((((((((((.((((.(((....((.(((.((((.((.(((.((((.((((.....)))).)))).)))))...))))))))).((.(((((.((.((.......)).)).))))).))...((....))..(((((((..((.....((........)).....(((((..((.((((((.(((.(((((((((((..((.((((((.....((.(((((((.....((((..((((((((.(.((((((...........(((((((((....).))))))))))).))).))))))))).(((.(((((((..((((((..((....)).)))).))..))))))))))((((((((.((((.(((((.(((((.((..((((((.....((((.((.((...)).))..))))......)))))).))))))).))))).(((((....(((((...((((....))))..)))))...)))))(((..(((((...)))))..)))......((((((((.((((.....(((.....))).((.(((...(((((((((.....))))((((((((....)))))))))))))))).)))))).))))))))((((((...((((((....))))))..))))))...................)))))))))))))))).....))))))).))..)))))).))(((((((((((((((.((((.(((((((((..((.((((((((.((....)))))...))))).))((((.((((((((..((((.((.(....((((((.....((((((..(((.(((.((.(((((.(((((....(((((....))))).((((((.........))))))......))))).))).)).)).))))))(((.((..(((((.((....................)).)))))..))..)))))))))))))))((((.(.((((((((((..((((....)))).)))))))))...).).)))).((((...(((((......)))))...)))).).))))))..))))))))))))...)))))))))))))......((((......))))))).)))))..))))))).))))))))))).)))...)))))).))..)))))....((((........))))......................((((..(.(((...))).)..))))..)).)))))))..))).)))).))))))))..))))...(((((..............))))).............)))))))))).)).)))(((((((((((...(((((.((((((((.((((((((..........((((((.((((((((((...((........(((((..(((..(.((((((((((((....(((((((((.((.....((((..(((((.(((((((.......((((...((((((.((((((..(((((((((((.((((((.(((...((.(.....((..(.((.....((..((((.((.(((((((......((.((((...)))).)).....))))))).)).(((((((..(......)..)))))))((.((((.(((((((..(.............)..)))).))).)))).)))))).))...)))..)).....)))...))).)))))).)))))))((((((((((((((((((((.....(((((.......))))).)))))))..(((((.(((...((((....))))..))).)))))((..((((.(((.....))).))))..))....((.((((((.((((.((((((.(((((((((((((.(((.(((......))).))))))))))))...(((((((((((((.......))))).....))).))))).......)))).)))))).)))).)))))).)).......)))))).))).))))((((((.....))))))....((((.((((((((((((...(((((((............))))))))))))))))))))))).)))).....)))))).)))))).(((((....(((((.......)))))....)))))...))))......))).))))...))))).)))).........(((((((((....((((((...((((..((.(((((...))))).)).........(((..(((((((((........)))))))))..)))))))....))))))................)))))))))...((((((...))))))..(((.(((((.....((((.((((((((((.((((((..............(((((.....))))))))))))))))..........))))).)))).....))))).))))).))))).)))).((((..........))))......)))))))).)))))))).))))).....))..)))))))))).((((((((((......((((..((.....(((..(((.........)))..)))))..))))........))))))))))))))))..........))))))))..)))...((((........))))......((((....(((..((....))..)))))))(((((....(((((((((((....(((((((..((((..........))))..))....(((((.((((((((.........))))))))))))).(((.((((((.((....))))))))...))).....((((((((.((...(((..((((...........))))..)))...)).))))))))((((..((....))..)))))))))..)))))))))))))))).................))))).))))).)))).((((((....)))).)).......((((((((.(((((((((((((((((........))))))).((((((((((((...(((...................))).)))).))))))))..((((..((((((((((((.....((((((((.(((((((..............((((((.(((.(((...((((((...(((((((((((.(.((((..(((....)))..))))).))).)))))))).(((((((.((......)).)).))))).(((((((.(((((((((...))))))))).)))))))...))))))....)))......((((((((((.............))))))))))...........))).))))))))))))).)))))))).............))))))))))))..))))...(((((((...((((((..(((..((((((...(((...))))))))).)))..))))))...)))))))..............(((.....((((((..((((((((((.((((((.((.((((((...)))))).)).)))))).((.((((..((((..((((((((.........((((((.....)))))).........))))))))..))))..)))).)).(((.(((((((...(((((.((...)).)))))......(((.....))).)))))))))))))))))))))))))).....))).....))))))))))))))).)))..)))))))..........((((((((((((.(((......))).)))))).))))))))))).....((((((((((.(((((.((...(((((((((.(((((......)))....)).))))..))))).....................)).)))))))))))))))...
Thermodynamic Ensemble Prediction
.(((((..,,..(((((.((({(((((({(((({(((((((,((((.(((,{..((.(((.((((.{{.(((,({((,((((,...,)))).)))).)))}}...))))))))},({,({(({.{{,({.,{....}}.||,|}|||.}}...{{,,,.)},}|{(({({|,{|....}||,.,,,||,|,.....(((((..((.((((((.{,(.((((((((((({{((((({.((((({.,,.(((((((((.....,,..((((((((.(.((((((,,...,,....(((((((({....}.))))))))))).))).))))))))).(((.(((((((..((((((..((....)).)))).))..)))))))))).))))).))))((.(((((.(((((.((..((((((.....((((.((.((...)).))..))))......)))))).))))))).)))))}},,,...}))))).,)))))}},...|||,,|.,},.,,||},,.(((((({((((.((((((((((......{((((((,.{{{({(,{{{({,,...,}}||{.|,,.,,||{|.((((,...,)))){{||{{{{.,,,)))))))),}}|||||{..,,))})))))))|((((((...((((((....))))))..)))))).,,,...............)))))....))))).)))).}))))))}}}))}}}}},,.,{(((((((((((((((.((((.(((((((((.{((.((((((({{((....))))}...))))).))|(((.((((((((..((((.((.{.,{,{(((((.,...{(({{{,.(((.(((.((.(((((.(((({....(((((....))))).((((((.........))))))......})))}.))).)).)).}))))}{,,.{{..(((((.{(,{{.,......,,.,.,},.),.}),,,...|..,},,)))}}}}}},.{|||.{{{(((((((((..((((....)))).))))))))).,,,.},}|||.,{{{...|||||.,,,.,}))))...}}}}.,.))))))..)))))))))))}...)))))))))))))......((((......))))})).)))))..)))))))}))))))))))}.)))...)))))}.))..)))))....,||,.,|,....}}}}................|,,...((((..(.(((...))).)..))))..}}.)))}))),.})).)})).)))))}}|,,}}}}...,,,{||}|,.....,,...}))}|,,.....,.....,))))))))).)).))}(((((({((((...(((((.((((((((.((((((((,,,.......((((((.((((((((((...{{........,,,,,.,{{.{((.((((((((((((....(((((((((.((....,((((..((({(.{((((((,,....,{|||,,.((((((.((((((..(((((((((((.((((((.(((...((.,.....,,..,.{,.....((..{{{{.{(.(((((((.,....((.{(({...}))).)).....))))))).)).(((((((..(......}..)))))))((.((((.(((((((..,.............}..)))).))).)))).)))))}.}),..))}..}}.....,))...))).)))))).)))))))(((({{{(((({{(((((({.....(((((.......})))).}))))))..(((((.(((...((({....}))),.}}}.})))},{..((((.(((.....|}}.}}}}..}|,,..((.((((((.((((.((((((.(((((((((((((.(((.{((......))}.))))))))))))...,((((,(((((((.......)))),.})).)))}||,,.....}}.)))).)))))).)))).)))))).)).......}))))).})}.})))((((((.....))))))....((((.((((((((((((...(((((((.........,..})))))))))))))))))))))).)))).....)))))).)))))}.(({({....({{{{.......)|||},{{{}}}}),,,.)))....,.,}}}})))...})))}.)))),.......,{((((((((....{{{{{(,,,((((,.((.((((,...})))).))....,,...(((..(((((((((........)))))))))..))))))}....))))))},,,....,,......))))))))}...((((((...))))))..(((.(((((.....{(((.(((((|||{,,|||{{,,.,..,}||||{{((((((.....)))))))|{{{{....}})),.,}}.))))).)))).,...))))).))))).))))).)))).((({...,,.....,}},......)))))))).)))).))).))))}.....}}..)))))))))).{(((((((((...{{{{,,,.}||..,,{(({{((({.........,,)}.)}}}}.,))})}}},....)))))))))))))))).....,,,..))))))))..))}...((({.....,,,|||,...,}}|{||...{(((..((....))..)))),,,(((((....(((((((((((....(((((,.{{(((......})))}.},|,,||,,,.(((((.((((((((.........))))))))))))).{{{.((((({,((....))))))))...)))..,,.((((((((.((,..(((..((((...........))))..))).,.)).)))))))){(((..((....}}..)))))))))..))))))))))))))))................,))))).))))).)))).,{,{{{....,,}}.},.......((((((((.(((((((((((((((((........))))))){((((((((((.....(((,.....}}}}.{{{{{....||{||{{{||,||||,..((((..((((((((((((.,...((((((((.(((((({.{(((((((.{{{{.,{,{{((((,,(({..{{((((...(((((((((((.(.((((..{{{....)))..}}})},))}.}))))))).((((({{.{,.,....}}.)).))))).(((((((.(((((((({...})))))))).))))))).,,)))))),,}..)),,....((((((((((.............)))))))))),..}}}}..)))))))),,,,))))))}.))))))))...........,.))))))))))))..)))}.{{((((({{...{(((((,.{{{..((((((...{{{...,||}}}}}).}}}.,))}))}.,,))}}}}|,,|..||.....,||{......||||||,.,{{{{{{{{{|((((((.({.{({{{|...,))))).)).))))}}.{|.((({..((((..((((((((,.,,..,..((((((.....))))))...,,.}},))))))))..))))..)))).}}{(((.{,,,,,.}}}|{(({.{{...)).))))).,}}}}}}}}}.....)})))))))))))))),,,,,,|||||,..,}}},}.....))))))))))))))).)))..)))))))..........((((((((((((.(((......))).)))))).))))))))))).....((((((((((.(((((.((.{((((((..((((,{,,.{((,,||.....}}})))}....).)))}...})))))}........}).)))))))))))))))...

Transcripts

ID Sequence Length GC content
GUCAGCACCAGCGCCUGGGCUGGAGGACAGAGAAGCCUUUUCCGUUGCC… 3812 nt 0.3851
Showing 21 to 21 of 21 entries
Summary

This gene encodes 54-kD nuclear protein that contains an arginine/serine-rich region similar to segments found in pre-mRNA splicing factors. Although the function of this protein is not yet known, structure and immunolocalization data suggest that it may play a role in pre-mRNA processing. Alternative splicing results in multiple transcript variants encoding different proteins. In addition, a pseudogene of this gene has been found on chromosome 12.[provided by RefSeq, Sep 2010]

Forensic Context

A study in humans demonstrated that the SRSF11 exhibited a significantly decreasing expression trend from 0 to 7 days after severe burn injury in blood samples, identifying it as a temporal expression profile gene [Wu et al. DOI:10.1016/j.burns.2018.08.022]. In mice selectively bred for differential methamphetamine consumption risk, the SRSF11 was identified as a network hub node among ventral midbrain differentially expressed genes overexpressed in the low-drinking line, with connectivity differing by at least 0.5 [Hitzemann et al. DOI:10.3390/brainsci9070155].