Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCGCCAUUUCGUGGACGCCGGGUGAGUGAGAGAGUUGGUUGGUGUUGGG… | 4228 nt | 0.3938 |
Summary
The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other non-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Forensic Context
A study in humans and other model organisms demonstrated that SRSF3 is a protein factor in miRNA biogenesis which recognizes the CNNC motif in the 3′ flanking region of primary miRNA transcripts to aid in the proper positioning of the Microprocessor complex for nuclear processing [Shang et al. DOI:10.1038/s41576-023-00611-y]. A study in mice demonstrated that the SRSF3 mRNA was down-regulated (0.26-fold) in bone marrow cells 6 hours after 6.5 Gy whole-body ionizing radiation, as identified by microarray analysis [Dai et al. DOI:10.1080/09553000600857389].