| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGUGCUCGCGUACGUCGCCGGGGUUCGGCUGCGUCCGUCCCGCCGCCC… | 2300 nt | 0.5143 |
Enables RNA binding activity. Involved in negative regulation of mRNA splicing, via spliceosome. Located in nuclear speck. Biomarker of Down syndrome; acute myeloid leukemia; clear cell renal cell carcinoma; and colon adenocarcinoma. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the expression stability of candidate reference genes, including Srsf4, was evaluated in a multiple-trauma model combining long bone fracture and traumatic brain injury [Otto et al. DOI:10.1038/s41598-020-71895-x].