| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUGUGUGGCUGGACUCGGCCGCCCCUGUGGUGUGAGGCGCGUGUUCGG… | 4353 nt | 0.3983 |
The protein encoded by this gene is involved in mRNA splicing and may play a role in the determination of alternative splicing. The encoded nuclear protein belongs to the splicing factor SR family and has been shown to bind with and modulate another member of the family, SFRS12. Alternative splicing results in multiple transcript variants. In addition, two pseudogenes, one on chromosome 17 and the other on the X chromosome, have been found for this gene.[provided by RefSeq, Sep 2010]
A study in mice demonstrated that the SRSF6 mRNA was down-regulated (0.16-fold) in bone marrow cells 6 hours after 6.5 Gy whole-body ionizing radiation, as part of a broader analysis of differentially expressed genes involved in processes like RNA processing [Dai et al. DOI:10.1080/09553000600857389].