Basic Information

Symbol
SRSF6
RNA class
mRNA
Alias
Serine And Arginine Rich Splicing Factor 6 SRP55 Serine/Arginine-Rich Splicing Factor 6 SFRS6 B52 Splicing Factor, Arginine/Serine-Rich 6 Pre-MRNA-Splicing Factor SRP55 SR Splicing Factor 6 Splicing Factor, Arginine/Serine-Rich, 55 KDa Epididymis Secretory Protein Li 91 Pre-MRNA Splicing Factor SRP55 HEL-S-91
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_006275.6
Sequence length
4353.0 nt
GC content
0.3983

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1194.00 kcal/mol
Thermodynamic ensemble
Free energy: -1279.77 kcal/mol
Frequency: 0.0000
Diversity: 1204.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((.(((((.(((((...((((((((((.((.(((.(....(((....)))....)))).))))))))))))....)))))...)))))))).......((((((((..(((((((...((((..(((.....((((.((((((.....)))))).)).)).....))).))))....))))..)))((((((((...((((((.((((((.((((.((((((.((((.((....))))).).)))))).))))............((((((((.((((..((((((((.....))))))))..((.((((((.((((.(((((....)))...)).)))))))))))).))))))).))))).)))))).))))))))))).)))..(((((((((.((((((((..((((((.....))))))..........((((.((...(((((((......(((..((((.(((((.(((((((((..((((..(((.....))).))))..))))))))).))))).))))..)))......(((.((.((....)).))))).)))))))..((((((((.....((((.........)))).((((.(.((((.((.(((((...((.(((((((..........(((((..........((((((((...))))))))........)))))..((((((((((((((((......)))))(((((......).))))........))))))).)))).(((((.((......((((((...)).))))......)).))))).(((((.......)))))...((((((........))))))...((((.((.....(((((..........)))))..))...))))((((((((((((..(((...((((((..((..(((....)))..)).)))))).....)))...))....)))))))))).(((...((...((((.....((((.....))))...))))..)).))).)))).))).)))))))...)))))).).)))).))))))))..)).)))).)))))))))))))))))....((((....((.(((......))).))....)))).((((..((((((((((...((((((((((..(((.....))).))))))..((((((.......((((((...((((((.(((((((((((..((((....(((((((((...((((((.(((.((((((....))))))........(((.((((((.......)))))))))..............))).))))))..(((((((.((.((.((.((((...((((.((((((((((((((((((.....))))))))))).(((((((((.(((.((((((((((.(((((..((((.(((...)))..))))..))))).................................(((((((...)))))))...(((((((..(((((...((((((((((((((.......((((((((..((((((.(((((((((...(((((((((.....((((...(((((((.((((((((....)))))(((((((......)))))))...............))).)))))))....))))(((((....)))))...)))))))))((((((...(((((.....)))))..))))))........)))))))))...)))))).....(((((((((((.((((((((..(((..((((((....((((((.((((..........))))))))))..))))))........((((.(((((.((((((..........)))))).))))).))))..(((((((((((((((........)))))))))(((((((.......(((((((.....((((((.(((((......((((((...)))))))))))((((((((......))))))))...(((((((((.....)))))))))))))))...)))))))((((((((.(((.(((((((..(.((((..(((..(((......)))..)))..........((((....)))).)))).)..)))))))))).))).)))))....((((.((((((....((......))..)).)))).))))))))))).(((((.(((((((((((........)).)))))....)))).)))))...))))))))).))))..)))).)))..........)))))))))))))))))))))))))))))).)))))....((((((.((((((.......))))))))))))...)))))))..(((((((((((((((.(((....((.(((.((((((.......................)))))).))).))))).)))))))....((.((((.......)))).)).....))))))))....)))))))))).))))))))))))....((((((((((...((....))...)).))))))))..((((.((((((((((((.(((((..(.((.((((((.((....(((...))))).))))))((((((((((.((((.((..(((((((.(.((((((((((((((((...((((.((((((((((((((((((..(((((((...(((((((.................((((.(.((....)).).))))....((((((.((((((((.....))))))))))))))...(.(((((((.......))))))).).....)))))))...))......)))))..))).))))))))).)))))).))))...((((((((((.......)))......(((((((((((....(((((...((((.((.((((((.......((((........))))..)))))).))..))))))))))))))))))))..(((((((...(((..((......)).)))..)))))))(((....)))........((((......)))).(((((((((....))))...)))))......)))))))(((((((((((((((....))))))...(((((((..(((....(((((......)))))....)))......)))))))...((((((((.(((((((((((...((...((((.((..(((((..((((......))))((((...))))..(((((.((((.........)))))))))............))))).)).)))).))....)))))))))))..)))))))).......)))))))))))))))))((..((((((.......)))))).))...((((((...))))))..((((..(((.........))).....)))).....))))))).).).)))))))))))))))))))))))..)).)..))))).)).)))))))))).))))...))))))).))))...)))).)).)))))))))))((((....))))..)))))))))(((((((.....)))))))......)))).))))))).(((((((((((..(((.((((((.((((........((((((((((.((...(((.....((((((..(((((((((....(((((((....(((((.((((((((((((((.....((....))..)))))))..((((((((...((((......))))....)))))))).....))))))).)))))....)))))))..(((((........)))))((((((........))))))))))))))))))))).))).)).))))))....((((....(((((.....)))))......)))).....))))........)))))))))).)))...))))))))))).........))))...)))))).))))))))))))(((((.(((........)))...)))))))))..))))))..))))))))((..((((((..((((....))))..))))))..))......(((((((................((((....))))..((((.((....)).))))((((....)))).(((((((.........))))).)))))))))((((......))))))))))))(((((((..((((.................))))....))))))).((((.......))))((((.....)))).(((((((..(((....)))..))))))).....)))))))....................
Thermodynamic Ensemble Prediction
((((((((((.(((((,(((((...((((((((((.((.(((.(..{,(((....)))}..}.))).))))))))))))....})))).,.))))))))...,.{((((((((((((((((((...((((..{((,....((((.((((((.....)))))).)).)).....})),)))).,..))))...,.((((({((,,.((((((.((((((.((((.((((((.{(((,{{....})))).}.)))))).)))).....,{...,,((((((({,((((.,((((((((.....))))))))..((.((((((.((((.(((((....)))...)).)))))))))))),))))))).))))).)))))).))))))})))),}))..{((((((((.((((((((..((((((.....)))))).........,((((,({...{||||||,......,,..((((.(((((.{((((((((..((((..(((.....))).))))..))))))))}.))))).)))),{||......}|||.((.((....)).)),}|,|||,,|,..((((((((.....((({....|||.,||||.{(({.{.{{(({((,(((({...{{,(((((((..........(((((..........((((((((...))))))))........)))))..((((((((((((((((......)))))(((((......),,))),.......))))))),)))).(((((.((......(((({{...,}.))))......)).))))).(((((.,....,)))))...((((((........))))))...{(((.{(...,,({{{{....,.....})))}.|}},..}}}}((((((((({{{,.{((...{(((({,.{{..(((....)))..)).}))))}..,,.))}...)),..,)))))))))){({{........,|||.,}}}((((.....))))...|||...,,..|||||},.}}}.)))))}}..,)))))},),)))).))))))))..}).}))),))))))))))))))))|{{((((((((((((.,((((..,.{{{.(((((.(({...})}..))))).}||,,..||}}((((((..(((.....))).))))))..{((((,((({{.{(((((((({((.{{{{{.,,,,(((((..,.,{,.{({{(({{{,||,||(((((,,||.((((((....)))))).....||||||.((((({.......})))))|||,,,{{|{.,,....|||{{{{||,.,{((.((((((,((((.{(((({{{(....,,,,.,((((((((((((.....))))))))))))(((,,(((((({{,,{{((,,,.|,,|||,},||||}||...}}},..,...........................................,((((((...))))))}.}|||}}}}}.}}}|,|}}}|{||||||||||||},,,...,{{,,{{{{{((((((,{{{{|||||}}}|{|||((({...,,|{{{...(((({{{.{{(({{{{,...}}|||{{{{|||..,,,,)}}}}}}....}}},,}},,,)))).))))))),,,,)))}{{{{|,,..)}))).,,))}))}}},((((((.,.(((((.....))))).,))))))........}}))))))),,,)))))},,},,|||{{{,{{.......,|,,},|}}}}||{{{,....((((((.((((.,......,.))))))))))..,}},})}}},,,....|,.{((((.((((((,,.....,,.)))))).))))}))))}|||}}}}.{((((((((........)))))))))|||||,....}}}|,{(((((,,,,.{{(((({,...|}}}||.(((((,...,)))))||||.,,|,||||.,,,,.,,,|}}}}..,(((((((((.....)))))))))))}})),}}}}))}))},|,}}}}}}}}))}),}}}},))))))),,)))))},.,{{{,{{,{{{({,,,,||}}|.((((....))))..((((((.{(((.(({,|.,|.,||{{{,{{{((((.((((((,...{{......}}..}},}))).)))))}|{{{{{(((((.(((((((((((........)).)))))....)))).))))),,,||,,,,,,..{{{........}}}{{{{{||.{{|,||||,|....,,,}.)))),))}..})}}}}},|,,,,(((((((((({{,.,,,,,,)))))}))))))})))}},,,{{((((((.....,.)))))))),,(({.,.,{{{(..,.....}}}}}}}.,,}.}}},}}},,})}})}))).)))).)))))}||||||,,,|,....{{{|||{{|,...,{{{,,,|{{{{{{,.,|||,,,,.|||,|,,||||{....((((((((,,,,.({....}}...,..))))))))..|||..||||||||{(({.,,,||)))))))||||||}}}))),.))))))))))),))))}{(((((((({{((((.((..(((((((.{.((((((((((((((((...((((.((((((((((((((((((..((((({{...(((((((.,,,...........{,((((.(.{{....)).).))},.{,,((((((.((((((((.....)))))))))))))),,.{.(((((((.,...,.))))))).}.,,,.)))))))...))......)))))..)))})))))))))))))))).))))..{{{,{((({,{,,.{{{{{||.,,,,.,,.,((((((((,.{(((((,.....}}}}.))..,)))))}},,((((((((.,....,,.)))))))},,....,}}}}}}}}}}}.||}|}}|||{{||..,,{(.,(({{,{{{{({.......)))))},}}))})}}......,,..(({{{{..,,,,.,((({(({(....)))))}},}}}}.,.}}})))}})}((((((((((((((,....}))))|..{,((((((,,{.{..,.((({{......}))))...,}}}||,,..}})))))...|(((((((.(((((((((((...{{...((((.,{..(((((..((((......))))((((...))))..(((((.((((.........)))))))))............))))).}}.)))).}}....)))))))))))..)))))))),,,,,.,)))))))))}))))))),,..((((((.......)))))).},...((((((...))))))..((((..{{{.,,......))).....))))..,..))))))).).}.)))))))))))))))))))))))||||{|,{|||||{||{|||||{{{{|{{|||{{{{{((({{.{.{{{,.,},),.))),)})))))}}|{({,...||||,.,||||||||(((((((.....)))))))..||.||,||{|,|||,,.{((((((((((..(((.(({((((((((........((((((((({.{({..(((.,...((((({.,(((((((((....(((((((..,,(((((.(((((((({(((((.....((....)}..}}}}})}..((((((((...((((......))))....))))))))....,))))))).))))).,,.)))))))..(((((.{....}.)))))((((((........))))))))))))))))))))),))).,}.))))))....{(({....(((((.....)))))..,...}))).....))))........)))))))))).)))...})))))))))}..,{{{....((((......))))}}},..,{{,,......|||,,............}}}.)))))}.}}...(((((((.(({((..((((({..((((....))))..})))))..))..}))))))))),,||,,|,,........((((....)))).,|{{|}||}}}})),))))||||,,,,})))..}|}))}}},}}}}.,|}}}}.,}||.|,|{{{{{......)))))))))))|{((((((..{(((.....,,...,.,,...))))....))}}}))}((((.......)))}((((.....)))).(((((((..{{,....,))..))))))).....)))))))...,,.....},........

Transcripts

ID Sequence Length GC content
AUUGUGUGGCUGGACUCGGCCGCCCCUGUGGUGUGAGGCGCGUGUUCGG… 4353 nt 0.3983
Summary

The protein encoded by this gene is involved in mRNA splicing and may play a role in the determination of alternative splicing. The encoded nuclear protein belongs to the splicing factor SR family and has been shown to bind with and modulate another member of the family, SFRS12. Alternative splicing results in multiple transcript variants. In addition, two pseudogenes, one on chromosome 17 and the other on the X chromosome, have been found for this gene.[provided by RefSeq, Sep 2010]

Forensic Context

A study in mice demonstrated that the SRSF6 mRNA was down-regulated (0.16-fold) in bone marrow cells 6 hours after 6.5 Gy whole-body ionizing radiation, as part of a broader analysis of differentially expressed genes involved in processes like RNA processing [Dai et al. DOI:10.1080/09553000600857389].