| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGUGAGUUUUGGAUAGUAAAAUAAGUUUCGAACUCUGGCACCUUUC… | 828 nt | 0.4662 |
This intronless gene encodes a transcription factor that is a member of the high mobility group (HMG)-box family of DNA-binding proteins. This protein is the testis-determining factor (TDF), which initiates male sex determination. Mutations in this gene give rise to XY females with gonadal dysgenesis (Swyer syndrome); translocation of part of the Y chromosome containing this gene to the X chromosome causes XX male syndrome. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the SRY is a highly expressed circular RNA in testes [Memczak et al. DOI:10.1038/nature11928].