| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACCAGCGGCGGCGGCGGCGGCGGCGGCGGCAGCGGUGCUGGAGGCGC… | 3252 nt | 0.5514 |
Predicted to enable single-stranded DNA binding activity and transcription coactivator activity. Predicted to be involved in positive regulation of transcription by RNA polymerase II. Predicted to act upstream of or within hematopoietic progenitor cell differentiation. Predicted to be part of transcription regulator complex. Predicted to be active in nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in human traumatic brain injury (TBI) patients identified the SSBP3 as one of the top five downregulated long noncoding RNAs in brain contusion tissues compared to adjacent tissues, with a log2(fold change) of -5.85318, and this differential expression was validated by quantitative real-time PCR [Zhang et al. DOI:10.097/WNR.0000000000001756].