| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUUCUGGGGCCGCUCCAGCUGGUGCCGGCCACCUCCACUCCCCUUU… | 2800 nt | 0.6304 |
The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins, some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern.[supplied by OMIM, Apr 2004]
No relevant information is available at the moment.