| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAAGCCGCUUUAGGAGCGAGGUUCGGAGCCAUCGCUGCUGCCUGCUGA… | 607 nt | 0.5470 |
The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
A study in cynomolgus macaques demonstrated that chronic methamphetamine administration decreased hippocampal expression of the SST mRNA, a neuropeptide that protects against glutamate-induced excitotoxicity, as measured by RT-qPCR [Choi et al. DOI:10.1016/j.taap.2018.05.031].