| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCCAGCGGCGCAGCCACCCAUGCGCGCGCGCUCGCAAGACCACCAG… | 7685 nt | 0.4569 |
Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney. [provided by RefSeq, Jul 2008]
Soluble suppression of tumorigenicity-2 (sST2) is a reported biomarker related to heart failure triggered by acute myocardial infarction [Chen et al. DOI:10.1186/s12920-021-00890-6], though its reliability remains controversial [Chen et al. DOI:10.3389/fimmu.2022.878876]. The SSTR2 is recognized as a myocardial stress marker that can identify heart failure patients at risk of sudden cardiac death [Lou et al. DOI:10.1016/j.jflm.2022.102332].