Basic Information

Symbol
ST14
RNA class
mRNA
Alias
ST14 Transmembrane Serine Protease Matriptase MT-SP1 SNC19 TMPRSS14 PRSS14 CAP3 HAI Suppression Of Tumorigenicity 14 (Colon Carcinoma) Suppressor Of Tumorigenicity 14 Protein Membrane-Type Serine Protease 1 Serine Protease TADG-15 Serine Protease 14 EC 3.4.21.109 Matriptase Prostamin TADG15 Suppression Of Tumorigenicity 14 (Colon Carcinoma, Matriptase, Epithin) Tumor Associated Differentially Expressed Gene 15 Protein Tumor-Associated Differentially-Expressed Gene 15 Protein Suppression Of Tumorigenicity 14 Channel–Activating Protein 3 Channel-Activating Protein 3 EC 3.4.21 Epithin ARCI11 MTSP1
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_021978.4
Sequence length
3305.0 nt
GC content
0.6215

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1416.40 kcal/mol
Thermodynamic ensemble
Free energy: -1470.30 kcal/mol
Frequency: 0.0000
Diversity: 953.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((...(((((((.....(((((.((((((.(.(.(((((((((((((((((...(((((((.(((((((((((((..(((.((((((..(((((..(((((((...((((...))))...)))))))..))))).))))..)).)))..)).)).)))))....)))).))).))))))))((((.((((((((..((.((((((((.(.........).))))))))..((((..((((.(((((((..((....((((.(((((......)).....))).))))....))...)))))))))))))))......((((...((((.....(((((.((((((....)))))).))))).((.((((((((..((((((((((((......((((((((((..(((((((((((..((....))..))))))))((((.(((((((.((((((((((.((....)))))))))).............)).))))))).)))).((((((.(((((....))))).........((((((..((((((..((((((((((((..((((((((((.((.(((......(((.......)))...))).)).))))).)))))))))))).......))))).))))))....)))))).)))))))))))))).)))))......))))))))))))...((((..(((.(.(((((((...((((.(((.((((((((((((.((..((((..((((((((((((((((.....))))))).(((....)))............))))))))).)))).(((.(((....))))))....)).))))))))).).)))))))))))))))).)...))).((((........))))....((((((....(((((((...)))))))...))))))((((((....((((.((((..............)))).))))....))))))...)))))))))))).)).))))..))))(((((...))))).))..))))))))..))))..)))))))))).))).).)((((((..(((((..(((..((.((((.(((.(((((((((((....((((((.(((((..(((((...........((((.((((.(.(((((((((((((((..(((((...((((((((......).))))))).)))))..))))...))))))).(((((.(........))))))......(((......................)))....(((((((((((((((((......((((((.(((((((............))))).)).)))))).....)))(((((....)))))(((((((..((..(((.(((((.((...((((((....((((.(((......)))))))............((....)).....((((..(((........)))..)))).(((.......)))..(((((....))))).....))))))...))))))))))..))......))))))).......(((((((((.(((((...(((....)))))))).))))).))))(((((((((((((((......(((.....)))...((((.(((((...((..((.((..((((........))))..))...))..)).((......))((((.((.((((.......)))))).))))....)))))..)))).))))))))....))))))).)))))..)))))))))..)))).))))).)))).........)))))..))))).))))))....(((((.((((.((.....))...)))))))))((((((......))))))........(((((.((..(.(((((......((((.....))))..))))).)..)).)))))..))).)))))(((((((((.(((((.(((..........))).).))))..)))))))))...((((((.....))))))....)))))))).)).)).))).))))).(((((((((((((.....(((......)))....))))))))))).))...)))))))))))).)).)))....)))))))..))))))(((((((((.............(((.((((..(((.(((((((((..((((((((...(((((((((((..(((.(.....(((((.((((.((((((...))))))....)))).)))))..).))).....(((((.(((.........((..(((..........)))..))((((((.((((((((.................))))))))))))))((((((...(((((((((.((................))))))).))))....))))))..))).))))).....)))))...))))))..(((((((((.(((((.....))))).))...))))))).........))).)))))....(((((.(((...(((.((((.((...)).)))).))).((((((((((((..((.(((((((......(((.(((....)))(((((((((((((((.((......))))))))).)).)))))).)))(((((((.((..((((((.(..((.((((.((((.((..((((((((((((((((((..((.((((........))))))................((((((....((((.((((((.((((..((....))..)).)))))).))....))))))))))))))))))))))...))))......))..)).)))).))))))..)..))))))..)))))))))...........((((((((((((.....(((((((...((((((((((((.((((.((((...)))))))))))))).....))))))...((((((((((((((.(((..((((((((...(((((((....)).))))).))))....((((((((((.(((.((.((((....))))...)).)))(((((((.(((....)))))).))))....))))).))))).....))))...))))))))))))))))).)))))))..)))))))).))))))))))))))))))))))))))))..)))))...(((.....)))..))))))))))))..)))).)))..(((.((....)).)))....)))))))))(((((((....)))))))............))))....
Thermodynamic Ensemble Prediction
{.(((((.((((...(((..((((...((((..,((((,.(.(.(((((((((((((({((,..(((((((.(((((((((((((,,(({.({|(((..(((((..((({(((,,,{({(,,,||||,..})))))}..})))}.))))..)),))).})).)).)))))....)))).))).))))))))((((.((((((((..({.((((((((.(.........).))))))))..((((..((((.(((((((..((....((((.(((.(,.....||,...|})}.))))....}}.,,}))))))))))})))......((({...{(((,|...(((((.((((((....)))))).))))).((.((((((((..((((((((((((.,,...((((((((((..(((((((((((..((....))..))))))))((((.(((((({.,,((((((({{((....)))))))))),,{{{.......}))}))))))).)))).((((((,(((((....))))).,.......((((((..((((((..((((((((((((..((((((((((.((.(((......(((.......)))...))).)).))))),}))))))))))).......))))).))))))....)))))).)))))))))))))).))))).,....)))))))))))),}|||,{..{||,{.(((((((,..{(((.(((.((((((((((((.((,.((((..((((((((((((((((.....))))))}.(((....)))...........,))))))))).)))).....|||{{{{{{....),,}))}))))))))).).)})))))))))))))).},,,))),((({,,...,..}))}....((((((....(((((((...)))))))...)))))){{{(({.,..((({.({{{,|.......,..},)})).))))..,,)))))),}}),}})))))))).)).})))..))))(((((...))))).})..))))))))..)))).,)))))))))).))).).)..}.})).,)))).)))}......)))...)))).))}})).},{{,.((..(((((((.((((.((({.,..((((((((,(({(({...,,(((({{{{|||,.{{{{(,,,((((((((......).))))))).))))),,)))}...}}}}}}}.(((((.(........}))))).,,,{{,,((|{,{{.{(((,,,.....{{...,,...(((((((((((((((((..{(({(..((({(((({(({|.|,,,,,.....,,,})}.)|||||,{|(({{{(((((({{((((||(,(((((..((.,{(({(((({.{(..,((((({....((((.(({,,,,,,|}}}}}}..{|,,,.....((....)).....((((..(((........)))..)))).({{.......)))..(((((....)))))....,)))))}...)}}}}))))}..,|.,.}}|)|})|||||,,|}}|||{{{{||,|||||,,.{((....))||||}|,||||}.||||{((({,{{||||,|}}..,,,||||...,))),..||))})||)|.|}||}||,}.}},|}}}}}}|||.,(({....,))}||,.{(((((((((((.((((.((.((((.......)))))).))))..)))....))).))))))))}))}}}.,))),,,.}))}}}}}}))))))}.||)),}|}}})|,,.,.....((((({((({.{{{,,..||,||{...{((((.((((.((.....))...))))))))}(((((((.(((((....{{{.....,||,,....(((.{((((({..{{(((((((....)).,)))),.)},)))).))).)))((((((((.(((.(((....))))))..((((..((.((((.{(.{(({(((((.((...((((((.....))))))..((((((((...{,,,|.((({((((({(((((((((((((.{{..(((......))),,..))))))))))).)).}}.,.,},}))))))))))))))))){{(((((.(({{({((..((((((....,,...,...||.,..|,.({{..,,.,}}}....))))))..)}||{{...,||}}........,)))))))))).}}((((((...))))))..)).))))),)))}}))))))).)))).....)))))))).)))))))))))))}).}}.,..)}).)))))))))).(((({.....}}}}}.{{{{.,,))))||||||||((({{({{((((((({((.{({{{{{.,,{,,{{,{{.|||}|,,,|||{...}})))).),)||{|||,,....}}}))}.,)))))).,{((((((((.(((((.....))))).))...))))))}.....{{{....,}}},|,{..,|||{,{||||}||||||{{.|||||}),}},.,,||.{(((((((((((|.{{.{((((((.{,{||,,,,))).,..,||(((((((((((((((.((......))))))))).)).)))))).))|(((((({{((..((((((.{..((,((((.((((.((..{{(((((((((((({{,{..||.{(((,.,....,)))},},,.,,.....,..|{|((((((...,(({{.((((((.((((..{(,...})..)).)))))}.))....}))})))))))))))))))))),..}))),.....))..)).)))).}))}}),,),.))))))..))))))))).|........,|({(((((((((.....(((((((...((((((((((((.((({{((({...}))))))))))))).,..,)))})}...((((((((((((((.{((..((((((((...(((((((....,,,)))))|}}}}.{{{(({{{{{|||}|{(.((,((((....})))...||,}}}(((((((.(((....)))))).)))).,,,))))),)))))}}}}}))))...))))))))))))))))).))))))).,)))))))))}))))))))))}}))))))))))))|)),|||||}...((({(((((({..,({{{...))))....))))))).}}})}))),,))))))...))))))),.,)))}.))))..)))))))..)).,}}}...........

Transcripts

ID Sequence Length GC content
GUGAGAGCGGAGCUGCAGCCGGAGAAAGAGGAAGAGGGAGAGAGAGCGC… 3305 nt 0.6215
Summary

The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human patients identified the ST14 as one of ten hub genes for predicting heart failure progression after myocardial infarction via machine learning algorithms [Xu et al. DOI:10.3389/fgene.2025.1592985].