| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUGAGAGCGGAGCUGCAGCCGGAGAAAGAGGAAGAGGGAGAGAGAGCGC… | 3305 nt | 0.6215 |
The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
A study in human patients identified the ST14 as one of ten hub genes for predicting heart failure progression after myocardial infarction via machine learning algorithms [Xu et al. DOI:10.3389/fgene.2025.1592985].