| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACAGUUUCGACACUUUGCAAAGACAAAGAGCCCUAGACCGGAGGGAG… | 6918 nt | 0.5194 | |
| AGACAGUUUCGACACUUUGCAAAGACAAAGAGCCCUAGACCGGAGGGAG… | 6715 nt | 0.5194 |
The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
A review of transcriptomic studies in humans, mice, rats, and rhesus macaques indicates that the ST3GAL1 (ST3 beta-galactoside alpha-2,3-sialyltransferase 1) is differentially expressed at baseline between alcohol use disorder (AUD) and control lymphoblastoid cell lines and is affected by ethanol exposure [Ferguson et al. DOI:10.3389/Fnmol.2022.1032362].