| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGCCUGUGCUGUGCCUGCCUCCUAGAGCUCAUUCCCUACGCCCCGACU… | 7928 nt | 0.6256 |
This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the STAB1 is a highly significant subcluster-defining gene in the 'Anti-Inflammatory' macrophage population within the meninges [Bolte et al. DOI:10.7554/eLife.81154]. In a separate study in rats, the STAB1 was identified as an orthologous gene associated with inflammatory processes in a model of radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357].