Basic Information

Symbol
STAB1
RNA class
mRNA
Alias
Stabilin 1 FEEL-1 MS-1 Antigen KIAA0246 CLEVER-1 STAB-1 FELE-1 SCARH2 FEX1 Fasciclin Egf-Like, Laminin-Type Egf-Like, And Link Domain-Containing Scavenger Receptor-1 Fasciclin, EGF-Like, Laminin-Type EGF-Like And Link Domain-Containing Scavenger Receptor 1 Common Lymphatic Endothelial And Vascular Endothelial Receptor-1 Stabilin-1 FEEL1 HRFT
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_015136.3
Sequence length
7928.0 nt
GC content
0.6256

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3618.50 kcal/mol
Thermodynamic ensemble
Free energy: -3748.62 kcal/mol
Frequency: 0.0000
Diversity: 1771.41
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((((.((((((.(((...........((((.(((((((..((((.(((((((((((.((((.(((....)))..))))...((((.((((((((......((((((((((((((((.((((...((((.(((((((...((((((((((((((....((((.((((.((((((((...)))).))))))))((..((.((((.((((..((((((........(((....)))(((((((.((((((((((.((.(((.((..........)).))))).)))).....))).))))))))))((((.((((...))))))))))))))..))))..)))).))..))....(((((((((((((((..((((.((((.(((((((.((((..(((((...(((..(((((.........))))).))))))))..)))))))........(((((((.(((((.......))))).)))))))((((...))))((((((.(((((....((((((((..((((......))))..))).((..(((((.((.(((((((....))))))).)).)).)))..))((((.....(((((((((.((((.((((.((...(((.((((((.(((...))).))).)))...))).........))))))))))...))))))))).....))))..)))))....)))))...)))))).(((.(((....(((.((((((..(((((((((((.(((.(((((.....(((((...(((..(((((..((..((((......))))))..))))))))...)))))..))))).)))))))))))))).......((((....))))....))))))..)))..))))))..(((((..((((....(((.((((...)))).))).....))))..))))))))).)))))))))))))))))))))))(((.(((((....))))).)))....((((..(((....))).))))...(((((....((((((((((((((((((((((.(((...(((.((((((....)))..))).)))..)))))).)).))))))...)).)))).)))))..))))).))))...)))).)))))))))))))))))...)))))))).))))).)))))(((((((((((((((((..(((.(((.((((((...))).))).))).)))(((....)))......(((((((.......(((.((((((((((.((((((.((((((.((((((((((........(((.....)))...((.(((((((.((..........))))))))).))...))))))))))...)))))............).))))))))).))))))))))((((((((...((((((((((................((((......))))(((((.(((....((((.((((((((((((((.(..(((.((((.((..((((((....(((((((((..((((((..(((...((((.(((((((((((((((((((((...))).)))).)))).......(((....)))..(((((....)))))...(((((.........(((...))).........)))))((.((((...)))).)).(((((((((.((((.((..((((((((((((..((((((..(((((..(((((((.((((.((((((...((((.....((((((.(((........(((((.((((((((((((.((((((.......(((((((((((((((.((((((......))).))).))))))......(((.(((....)))))).)))))))))..........((.((((.....)))).))(((((((....)))))))(((((((.((((((.((.((((.((((((...(((((...)))))..))).))))))).))))))))...................(((....)))))))))).((((((..((((....))))....)))))))))))))))))..((((((.......((((((((..((((.....(((.((.(.(((((((.((((....)))).)))))))).)))))........))))..).))))))).....))))))..))))))).))))).(((........)))....)))))))))...))))....))))))..).)))))))))))))))....)))))).........)))).)))....)))))..)).)))).))).)))))).....)))))))))).))))...)))))))))...(((((.((((.(((....((((.(........).))))))))).)).))))).))))))).)))))))).(((((((.(((((((..(((((.(((.(.(((.(((((..(((((.....))))).....))))).))).)..))).))))).))))..))).))))))).....((((((...((((..((((........))))))))...)))))))))))).)))..).))))))))...))))))))))......))))))))))))))))))..))))))))......((((((((((((..(((((.(((((..((.((((((((((......))))))).)))))..)))))..((((((((.(((((.((...(((.....))))).)))))))((((((((......))))))))(((.(((((((....((((((....((((((........(((((....(((((.((..((((.((((.(((((((((.(.((........))).))))))))).)))..).)))).)))))))...))))).((((((((.((((((...(((((((((...)))))..)))))))))).))))).)))(((((((((((.(.....(((((((((((........))))))((((.(((((.......))))).)))).....((((..(..(((....)))..)..)))).............(((........)))(((((..(((((((((((.(((((((.((((..(((((((.(((((((..((((((((((.(..((((..(((....)).)..))))..).))))))))))..)).....((((....)))).))))).........)))))))(((((((....))))).)))))).))))..))).)))))))))))((.((((.((.(((..((((..(.((.((...)).)).)....))))..))))).))))))...))))).)))))....).))))))))))).))))))....))))))))))).)).)))..(((......))).((((....))))..)))))))))))))))))))))))((((((((..(((((((.(((((((.(((((((((((((((.(((((((..((......((((((((((..((((((((((.......)))).))..))))..).))..)))))))....(((((....)))))))..)))))))..)))))).((((((.((((.((((.....((((((..(((((....(((((.(((((..(((((.....)))))(((.........))).((((((((...)))))..)))..((((((((....((((.(((...(((...)))...)))))))....)))))))).)))))..))))))))))))))))..)))))))))))))).)))))..)))).)))))))))))))))))).))))...))).))))((((((((((((((.....(((((...))))).......)))))).......))))))))))))))))))).))))))((((.((((((.(((....))).)))))).)))).(((((.((((....(((((((((((((((((.(((.(((((.((.(.....).)))))))))).))))))))).))))))))....)))).)))))...))))))((((((((((.(((((((((.((.((((((..(((((.(((((((.((......)).))))).)).)))))))).))).)).)))))))....)).)))))((((((......))))))...)))))...(((((((..(.(((...((((..((((((((((((((((...(((((((.(((..((((((...(((((((((((((.(((....))).)).)).....((((((((.....(((...((((((((((.((((((.((((.....))))((((((....(((((((((((((..(((((..((((.((((.(..((..(((((((((((.....(((((.((((....(((.(((((.(((((.(((((.(((((((((((((((((..((((.(((.(((...)))))))))).(..(((((((.(((((.(.(.((((((.((((((.((((((((((............)))))).)))).))..(((..((((.(((...((((.....))))))).))))..)))...((((((((((((((((((((((((.((((....((((((.((((((((((((....((.(((((((((.((((((..((........((.(((..(((.......)))..))).))..))..))))))....))))..........(((((((((...(((((...)))))..(((((.......)))))((((..((((.(((.((((((((((((.((....)).))))...........((((.....)))).....)))))))).))).))))))))(((.....((((.((((...)))).)))).....))).....)))))))))..))))).)))))))....))).)))).)).))))...))))((((((....)).))))...)))))))))))).)...))))))))))).((.(((((.(((((.(((...((...(((((.((((((((....))....(((.((((((((.((((.(((((((.(((((((.((((((........))))))..).))))))..(((...)))...)))))))..))))..))))))))))).(((((((((...((((((........))))))(((((((((((...((.((.((..(.((.((((((((((((.((.(((....(((((((((.((....)).))))((((((((((((.((((((....((....))...(((((((((..(((((.(((((((((((.((.((.....(((......)))(((((.(((((((((((((((..((((.((.((.((((((...(((...)))...)).)))))))).))))....)))..))).))))).)))))))))....(((((...)))))....((((.....((((.((((............)))).))))..))))((((((((((....((((.((((((((((.......))))).....(((((((((((.(((......((((((((((((...(((......)))...))))).))))))))))...))))).))))))..))))).))))..)))))))..)))...........)).)).))))))))))).)))......))..)))))))))...))))))))))))....)))))).)))))..))).)).)))))))))))).)).).....)).)))))))))))))))...)))))))))(((((.((((((.....)))))).)))))...((((.((((((.((((((..(((.....(((....)))....)))..))..)))).)))))).))))......)))))).))))).))...))).)))))))))).)).)))).)))))).).).))))).)))))))..))))))))).))....))))))).))))))))))...)))...)).)))...)))).)))))...))))....((.(((....)))))))))))).))..).)))).)))).))))).((((.((......)))))).)))))))))))))))))))(((......)))((((......))))...((((((((((((..((((((((((((((.((((..((((.(((..(((((.((.((((((.((((.....)))))))))).)).)))))....))).......)))).(((((((.((((((...(((((......)))))((.(((((.((((((((.((((.(.(((.((...((((((((((((((.((((.(....))))).))))))))...).))))).))))).).)))).)))))))).)))))...))..)))))).))))))).)))).))))))))))(((((.......)))))((((.((((((((..((((.((((.(.((((((....(((((...((..(((..(((.((((((((((((.(((...........))).)))).))))))..)).))))))..)).))))))))))).))))).))))......((((......)))).....)))))))).))))........(((((((..((.....))..))))))).......((((((((((((.((.....((((((..((((....))))))))))..))))))))).)))))..((((((...)))))).))))..))))))))))))(((((.((((...((((......(((((....(((((..((((...((.(((...(((((.(((.(((((((((((..((((((((((...............)))))...))))).))))))))(((........)))....((.((((((.((.(((.....))).)))))))).))....(((((((((.((.(((....))).)).))))))))))))))).))))).....))).))......)))).))))))))))...))))..)))).))))))))))).).))))))))))))..)))).)))).)))))))))...)))))).))))))))))((((.((((((((.((((..(...((((.((((((((((......(((((((.....).)))))).)))))(((.....(((....))).....)))(((((...)))))((((......))))))))).))))(((((((((.((.(((..(.(((((.(((((((((((.....)).))))))))).))))).)...))))).)))))).))))..)).)).)))))))).)))).....(((.....))).))).))))))))))))).))))((((((((((((((.((.(((((((..(((........)))..))))))).)).))))).((((((((.((((....(((((.(((((..(((((((........))))).))))))).))))).(((.(((.((..(((((..((((...)))))))))..)).))).))).......))).).)))))))).((((((((.........)))))))).........((((((...))))).).(((.....)))....(((((.....((((((((((((((.....((((((.....))).)))))))).))))..)))))))))))))))))))...))).)..))))))).)))))))).)).)).....))).)))))))))))))))))).).))))((((((((((((((...)))......)).)))))))))))).)))))))).).)))...
Thermodynamic Ensemble Prediction
......((({((.((((((.(((...........((((.(((((((..((((.(((((((((((.((((.(((....)))..))))...{{((.((((((((.,,,.(((,,..|||(((((((.(,,(,,,(((({((((((({,,((((((((((((((....((((.((((,((({{{{{,,,)))}.))))})}|{{..((.((((.((((..((((((.,,.....{({....,||(((((({{((((((((((.((.(((.((..........)).))))).)))).....))).))))))))))||{|.,{((,.,}}})))}|))))))..})||..)))).))..))}...(((((((((((((((..((((.((((.((((,,.,((((..(((((...(((..(((((.{.....}.))))).))))))))..))))|||{{{,{{{.(((((((.(((((.......))))).)))))))((({...})))(((((({(((,.(((((((((.(({...(((({...,,,,{{((((({..(((((.((.(((((((....))))))).)).)).)))..}.,})))).}}))))).)))..))).)))).))...}}||((({((,(((...))).}))),))..})))}}},{.{((({..(((||,,.,|{{|,..,,,..,...}}}})))))))))))),,.}})),,))}|||{((,....|||{(((((({.(((((((((({,(((.(((((.....(((((...(((..(((((..({.,((((......))))))..))))))))...)))))..))))).))))))))))))))....,,{((({,,..,}}|.,,||}|}||{{,,}..}))})}}}|||||,.,,,.}}.}|||}{{((,..}})),........,})))))))},)))).)))))))))))))))))))))))(((.(((((....))))).)))....((((..(((....))).))))...(((((....((((((((((((((((((((((.(((...(((.(({|{|,...}}}..))).)))..)))))).)).))))))}...,.)))).)))))..))))).)))),..)))).)))))))))))))))))},})..||||}.}}}}}.}))))(((((((((((((((((..(((.(((.((((({...})).))).))).)))(({....))}..,,.{(((((((.......(((.((((((((((,(((({{.,(((((.((((((((((...{{..,(({..,,.|||...{{.(((((({.,,.,,.........))))))}.)),,,))))))))))...)))))............}.})))))))).))))))))))((((((((...(((((((((({{,,,,..,,......((((......)))),,{{{.{{{....((((.((((((((((((((.(..(((.{(({{((,,(({(((....{{(((((((..((((({.,(((...((((.(((((((((((((((((((((...))).)))),,))).......(((....)))..(((((....)))))...((((({{.......(({...}))......}}}))))){(,((({...}))).)).(((((((((.((((.((,,(((((,,,((({..{{{{{{..(((((.{{((((((.((({.((((((...((((.,,..(((((({(((........(((((.{(((((((((((,((((((.......(((((((((((((((.((((((......)))}})).))))))......(((.(((....)))))).)))))))))..........(({({(({{...,,||{||(((((((....)))))))|,,||||.((((((.((.(((,{((((((...(((((...)))))..))).))))))).))))))))..........,}}}}.,|||((....||.,}}},)}.((((((.{((({....))))})..))))))))))))}})))}.((((((.......((((((((..((((.....(((,({.{.(((((((.((((....)))).)))))))}.)})))........))))..}.))))))).....))))))},))))))}.))))).{{{........)))....)))))))))..,))))....))))))..).))))))))))))))).{{{|},,,}.....,,,,)))).,))},,,)))}}..}).)))).))).)))))).....)))))))))).))))...)))))))))...(((((.((((.(((....((((.(........).))))))))).)).))))).))))))).})}))))},{((((((.(((((({..(((((,(((,{,(((,(((((,((((((.....)))))}..,.))))).))).,..})).))))).})))..))).)))))),...,.((((((...((((,.((((........))))))))...))))))}))))).)))..).))))))))...)))))))))),,.,},)))}})))))))))))))..))))))))......{(((((((((({.{(((((.(((((..((,{((.((((((......))))))),})))}..)))))..((((((((.(((((.((...(((.....))))).)))))))((((((((,....,)))))))){{{.(((((((....((((((....((((((........(((((....(((({.{{..((((.((((.(((((((((.(,((....,,,.}}).))))))))).)))..}.)))).}})))))...))))).((((((((.((((((...(((((((((...)))))..)))))))))).))))).)))(((((((((((,,((({,({({{((((((,.......)))))},,((.((((((((.,..{((((....,})))}|.)))))))),}}.{{|||{{{,,||{{{{.........}}||,...,}}}}),,|||||..(((((((((((.(((((((.((({..(((((((.(({,(((..((((((((((.(..((((..{((....)).}..))))..).))))))))))..)))..|,(((,....|)).,})|)|,........))))))}{{(((({....))))).)))))).))))..))).)))))))))))(,{((((.(,{(((..((((..{.((.((...)).)).,....))))..))))).)))))}....,))}.)})))))}.).))))))))))).))))))....)))))).,)))})},))){,{((......)))}((((....))))..))))))))))))))))))))))}((((((((..(((((((.(((((((.(((({{{{,((((((.(((((((.,,,.....,((((((((,.,,((((((((((.......)))).))..))))..).)..))))))))...{(((((....)))))),..)))))))..)))))).{{{((,.(((((.((({....(.(((((.((((((({((((,({(,,((....|}|}.))}))))){{...}}....))))),)}.)))))}))))))))),.,,{{{{{{{,....{{{{{((({{{(({,,.|||...|||}}}),,,,)))}}}))|{||.,.})).|((({|{|||}|||.},,,.,})))),))))))))}})))).))))))))))))))))))},)))...))).))))|(((((((((((((....,(((((...})))).,.....)))))).......)))))))}))))))))))).))))))((((.((((((.(((....))).)))))).)))).{{(((.((((,{..((((((((((((((((((((,.(((((.((.(,....),)))))))})))))))))))).))))))))..,.)))).))))|,({({((((((((({(({..(((({(({{{{{{((((((,,,,.}||}|||},((((((((.((((..(((.((.((((((((.({{...{({.{(.((((((.(.(((((.((((((({.((((.({..,((((....,,)))),..)).)))).{(((,.((((((((((((((((,..(((((((((((..((((((...(((((((((((((.(((....))).)).)).....((((((((.....(((.,,({((((((((.((((((.,,((.....}}||,(((({{,{((((((((,,(((.,{,(({{...,)).),,))}..))))))),.{((((.({{{{((....,((((((.((({(((((((.(((((((((((....,})))|,.(((({.((......)).}))))((({{{(((.(......|.}))))))))))))))...)))))).}))))((((((............))))))......})}}|||}}||||.}||}|,...,..,(((.((((((((((.((({{(({({((((,((.,,,|,|,||||.|,}.)))}..})).)))))||||||.))}.,.,||}||{|||||,}|.,,{|{,,,.,,.....{||||{,.((({,{{{,.||{{{{||{|....,((((((({{.{{(((,(((....,..|,{({,,,..,|((((,.,,||}(((.(((((.......))))).)))..,,|||{.{{(((({.((((((((...(((((((.....((((((((((((.(((((((({.....({.(((((((((((((((........)))))..{(((,,(((((..{((({..,.{((..((((...)))).,..))).}...))))}))))))))}}.(((((.(((.{{{((((.((.,(({((((,{...,),)))))))))))))))}))).))))).((.(((((.(((((.(((...{{...(((((.(((((({(....}}....(((.((((((((.((((.(((((((.{((((((.((((((........))))))..)}}))))}.|(({...}))...)))))))..))))..))))))))))).(((((((((..,((((((........))))))|((((((((((...((,{{.{(..{.((.((((((((((((.((.(((....(((((((((.((....)).))))(((((((((((((((((((,.,.{(..,}}}...(((((((((,,.,(((.(((((((((((.((.((..,{{({(,...,,,,,(((((.(((((((((((((((..((((.((.((.((((((...(((...)))...)).)))))))).))))....)))..))).)))))}}))))))))....(((({...}))))....,{{{.....{({({(((,..}}}},.....}},,.})))}.)))}((((((((((....((((.((((((((((.......)))))....,(((((((((((.(((......((((((((((((...(((......)))...))))).))))))))))...))))).)))))),.))))).)))).,)))))))..)))...,.......)).)).))))))))))).))).....}),..}))))))))...))))))))))))....)))))).)))))..))).)).)))))))))))).)).......}).}))))))))))))),...)))))))))(((((.((((((,...,)))))).)))))...((((.((((((.((((({..{{{.....(((....)))....))}..},.})))).)))))).))))......)))))).))))).,}...))).)))))))))).)).))))))).)))..)){{{{|((((((((((.((.,.(((((((((..{(((.(((.(((.(((((.((((,{{{((.{(|...,)),}}))),,}}),)),...{{,(((...,|)}|((((((((.((({{(({(.,((({{.||||,|((({,({{{.|,.|||||..{||((({(|((,(((.{((((......)))}|}.))}}}})))).}.|,,,..(((((....,..((((((((((.((((..((((.(((.,(((((.({.((((((.((((.....)))))))))).}).)))))....))).......)))).(((((((.((((((...(((((......))))){(.(((((.((((((((.((((.{.(((.((...((((((((((((((.((((.(....))))).))))))))...).))))).))))).}.)))).)))))))).)))))...}}..)))))).))))))).)))).)))))))))){((({.,....,))))),,))}}}))))),.,)}}}}))),,)}}})))))..}))))))}...,.})))}))).,.((((((((((.(((.{,.....,,.))).))))}})))))...)))))).))).)))))))))))))..)))))))))))).,.}},|,..}))))))))....((|{{((.|,...,.|,}.}|||{||,..,,.||,|,...,))))}).......)))))))))))).)))))))((((((..((((....))))))))))..))))))))}.}}},|{{((,,{|}}})})|}|,,}}||,|}||},.}}}))|||||.|||||...|||,,,,..)))||.}})|))}),})})}}))))})),..)|||||,|||((..((((((((..{{{..,|||})))))))..),.,,{(((((....)))))),|||||,{{{...,|||{}},...{((.((((({{((.(((,...,))).)))))))).))|,.,{{{{|{|{{.|{.|{|,...))),)).}))))))}||},)}..})))}...,,)))),,,,,,.{(((.,(||(((((......))))))}}})))),,)))))).).))))))))))))..)))).)))).)))))))))...)))))).)))))))))|((((.((((((((.((((..(...((((.((((((((((......(((((((.....),}))))).))))){{{,{{..(((,...}))..,..)))(((((...)))))((((......))))))))).)))}(({((((((.((.(((.,{.(((((.(((((((((((.....))}))))))))).))))),)...))))).)))))).))))..)).)).)))))))).))))}....,,,....,},).))))))))))))))))).}}}}.{{{{{(((((((((((.(((((((..(((.,....}.)))..)))))))((.(((.......))).))..))))))))))))},}))))))).,})))).})))))))).))))).)).)))))).)))))..))))})))))))(((((.,,.))))).....|||,|,{,.,...,})),))))))),.}..|||||..,}))).)))))).,}))}))),,...,||}}|}.})))}}}|,}}}}},,,|}|..,}}},,}.....||{|{((((|{{(({{,..((((((.....))).)))))))).))),..,})))})))))}))))}}}..,||}}}}}..,,,...)))))))).)).},......))}}))))))))))))))))).).))))((((((((((((((...))),.....}).)))))))))))).)))))))).).)))...

Transcripts

ID Sequence Length GC content
CUGCCUGUGCUGUGCCUGCCUCCUAGAGCUCAUUCCCUACGCCCCGACU… 7928 nt 0.6256
Summary

This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the STAB1 is a highly significant subcluster-defining gene in the 'Anti-Inflammatory' macrophage population within the meninges [Bolte et al. DOI:10.7554/eLife.81154]. In a separate study in rats, the STAB1 was identified as an orthologous gene associated with inflammatory processes in a model of radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357].