Basic Information

Symbol
STARD5
RNA class
mRNA
Alias
StAR Related Lipid Transfer Domain Containing 5 StAR-Related Lipid Transfer Protein 5 START Domain-Containing Protein 5 START Domain Containing 5 MGC10327 StAR-Related Lipid Transfer (START) Domain Containing 5 StARD5
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_181900.3
Sequence length
4887.0 nt
GC content
0.4909

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1574.80 kcal/mol
Thermodynamic ensemble
Free energy: -1665.82 kcal/mol
Frequency: 0.0000
Diversity: 1381.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........(((....)))((((((((((((...((((((.((.(((.((((((.((((...((((.((.(.((((.((((((.(((......))).((.(((((((((((((((((((((((.......((.(((((((((.(((((((((.((((((((((((((.......).))))))))))))).((((((.((((...(((......(((((((......((..((((((((((.((((...((((.((((.(((((....((..(((.((.(((((((((((((((((((((((........)))))).......((((.....)))).(((.((............)).))).(((((((((((..........))).)))))))).(((((((..........((((((((((((((((.....)))))....((((....))))...)))).)))))))((((((((..((((((....(((((...(((((((....))))))))))))..))))))))))..))))....))))))).......))))))))))))..))).)).)).))).))....))))).))))...((((.((((((....((((((.(((((((((..(((((((.((((((.(((((........))))).........((((((((....)))))))).)))))).)))))(((((........)).)))(((((.....((((....)))))))))..((((((....(((((((((.(((.(((((((((((((.((.((((((..(((((((((.....(((((((((.((((.(((((.................))))).).)))..))))))))).....)))......)))))).......)))))).)).))))..))))....(((......)))))))).))).)))))))))...(((((...((.(((..(((((((....((.((((((..((((((((...(((....(((((....((.......))...)))))...)))...))))..))))......))))))...))....)))))))..)))..))....)).)))....))))))(((.(((((((((((((.........((((((.....)))))).(((((((....(((......)))...((((..((((((((((((....)))).........))))))))..)))).......(((((((......(((((((((..((((..(((.....)))....))))..)))))))))...)))))))..)))))))...(((((((.......)))))))..(((((.......)))))...........)))))))).))))).)))((((((((((....))))))...)))).))...))))).))))..))))))....(((((((((((.....)))))))))))(((((((((.(((((((((((((......)).)))).)))))))((((((((...(((((((((((.......)))).(((((....)))))....)))))))..)))))))).....(((((.....(((((.........))))).....)))))..(((((((....((((((..(((((((((..((((((.((....((((((..(((((((((((((((((......(((((((....((((..((((...((((((((((((.(((.......))).))))).................(((........)))....................)))))))..))))..)).))....))))))).....))).......))))......)))))(((((((((((((((....((.....(((....)))....))....))))))))))....)))))..........)))))..))))))))))))))..)))..........))).)))....))))))..(((((((.....))).))))(((((....(((((.(((........))).)))))....))))).............)))))))))))))))).................(..(((((((..((....)).)))))))..)(((((((((......))))..))))).......))))))))))....))))..)))).))))))))))..)))))))))......)))..)))).)))))).........))))))))))))))(((.((((.(((.......))).)))).)))(((((((((((...(((((..........)))))...((((((((((((((((((((..((((..((.((((..(((((((((....((.(((...))).))......))....))).)))).)))))).))))...)))).((((((..(((((..(((((((.....)).)).))).))))).)))))).(((((((((..(((.((((((...((.(.((((...(((.((((((((.((...((((...))))....)).)))))))).)))..)))).).))...(((.(((((((.((.(((((((((.(((((.((((((.....((((.....(((.(((((..(((.......(((....)))((((......)))).......(((((((.....))).))))..........)))..))))))))....)))).....)))))).).))))..))))))))).)).))))))).)))))))))..)))..))).))))))......(((......)))...(((...((((((((....(((.(((((((........)).))))).((((.(((((((........(((((((((....(((((((.(((.........(.((((((((...((((.((.((((((((((((((((......))))))....))))...)))))).)).).)))...)))))))).)((......))..))))))))))......(((((((((.....)))))))))..............)))))))))...))))))).)))).......((((...))))))).....)))))))).))).....))))))).....(((((((............))))))).))))))))))))))))))))........(((((((....)))))))(((((((((.(((((((((.....))))))))).))).(..(((((.....)))))..))))))))))).))))))))))((((((.(..((((((((((((..((((((......((((((((.((....((((((.((.((.((((.(((((..((((...(((.(((((...((((.((.....((((.((((((...((((.((..((((.(((.(....((((...))))....).))).).)))..)).)))))))))).)))).......)))))))))))))).)))).))))))))).)))).))))))....))))))))))((..((...(((((((((((((((...((((((((((...((........))....))))).......)))))..)))))))))))))))..))..)).....)))).)))))))...))))).))..).))))))...(((.(((........))).)))..)))))))).)))).)))))..((((..(((((........)))))..))))(((.((((((((...((.((.(((((((((((((((((((((((.(((((.((((....))))......((((((.(((.....))).))))))..((((((....))).))).)))))..)))))).))))))))))...((((.....)))).......((((.......)))).)))))))))))))))))......)).))).(((........))))))))).).))).))).))))....))))....((((.(.((((((((............))))))))).)))).((((((..(((....(((.((((((.(((((((((((...)))..)))))...))).))))))))))))..)))))).((((...(((((.....)))))...))))..........)))))).))))).)))))).....)))....)))))..))))(((((((.((..................((((((................(((((........)))))..............((((((((((((((.(((...((((((.....((((...(.(((((.(((.(((((((.((((...((((((......)))))).(((((......)))))))))......))))))).)))(((((((..((....((((((((........(((((.((((((((((((...(((.(((((((((((....)))))))).))))))...)))))).....))))))...((((.........))))........)))))..(((.....)))(((.(((((.((.((..(((((((........))))).))..))...)).))))).))).....))))))))..))..)))))))......((....))((((((((.(((((((...............)))))))))))).)))(((((...(((.(........).)))..)))))))))).)...)))).))))))....))).))))))).)))))))))))))....((((.((....)).)))).((((((.....)))))))).)))))))...
Thermodynamic Ensemble Prediction
.........(((....)))((((((((((((.,.((((((.,{.(((.((((((.((((...((((.((.(.((((,((((((,{({.,{{{,{{|,{{,,{{{(((((((({{({{{(({{{...,,,,{{.(((.(((({{(((((((((.((((((((((((({......,).))))))))))))),(({(((.,{(({,,({{.{((.(((((((((.,,.((((.(((((((((((({((.{.((,..((((.(((((...,({..(((.((.(((((((((((((((((((((((........}}}}||,.{{{..,,,,.,.}}))}}.,||||,..,,,.......|,.|||,,{{{{{{{|{{,,.{{{,...))),,,,,)}}|.(((((((...,,...,.((((((((((((((((.....)})))..,.((((....)))).}}}))).)))))))((((((((..((((((....(((((...(((((((....))))))))))))..))))))))))..))))....))))))).}},..,,)))))))))))..))).)).)).))).)),,..))))).))))...((((.(((,,,.....}}|,|}||,||,|{|,.,|||||}}|}}|...||||({{{{{.{{,||||{....{{{.((((((((....)))))))},,))),}.,,,||{((((.((((({..(((((((....((({,.(({{{{{.,|{,||{{{((({({,.{,(((((((((.(((.(((((((((((((.((.((((((.,(((((((((.....(((((((((.((((.(((((............}....))))).}.)))..))))))))).....)))......)))))).......)))))).)).)))}..))))....(((......)))})))).))).))))))))}...,.,,{(({(({(((..(((((((....((.((((((..((((((((...(((....(((((....({.......))|..)))))...)))...)))),.})))......))))))...))....))))))),{||({({{,...{|{,,,....||}|,((((.{((((((((((((.........((((((.....)))))).{((((({...{(((......))),..,,,...,{{{{{{{((......,|||{....,}}})))}}|}}.||||....,,|,(((({{{.,...,(((((((((..((((..{|{,...,)}}..,,))))..))))))))}.,.}))))}},,}}}}))}||,(((((((.......))))))),.(((((.......)))))...........))))))))},)))}.)))|...((((((....))))))...}}}},,|,.,|||}},,}}),,||||||....(((((((((((.....)))))))))))},.((((...,||||||||||,|{{{{,,.,.))))))))))))|{||||||}}}||{{{{{{{{(,{{{.,{|||}.{||||||,,}})),.,}})))}))}},))))))))||||.(((((.,,(({((((.....,,,,|}}}|....,|}|||.}}}}|||,,,...,,,,|}}|||,|,{||},,|||||.|,....,,,||,..((({,(((,,|,,,}|}..}}}.(((((((....(({{,{((((...((((((((((({.(((,......,)),))))).................(((........)))....................)))))))..)))).})}.))....)))))))..)}))).....}}})))),.}}..{|||.{,(({...|||.,.}}}})))}}}}}))}....)))}}}}..{((((.,|{(((.......))))}.))))}....,,,,...,,)))))),))))},,,|{|{{|||{.,,||,||},,,,,{{|{{{..,|,,....,,,||,..))}}},}}}}.}|||}|}||,..}}}}}}))))))).|{|,,,...)}}......{{{((({.{((({.||{,(({,.,}}}}}}...........{{{{{({..,{....)}.))))))}.}))))))))}}}.............{((((({,({(((|....))))..,)).}))))))))))))))))}})))))).}).}}.,,)}}..}}}|.|||}},...,,,..,)))))))))))))).}}}{(((.(((.......))).)))}.|||(((((((({{,.,,|||||,|},......}}}}|,,,({(((({{((((((((((((,.,,{(,,(,,{(({,,{{{{{(({{....(({(({...,||{}}.,|,.,||,,,,}}}.||||{||||||{|},,...}}||.((((((..(((((..(((((((.....)).)).))).))))).))))))}|((((((((..(((.((((({,{,.,{{{(,(({{{(.({(({(((((.((...((({...))))....)).)))))|(((((.(((.(.((((.((((((((((((((..(({((({({{,.{({,..,,.{{,.....|||,,....|))}}}|}}..}}.))))))))}}})))))))).).))))))))}......}|||{|||,,}..))))})}}.,{{{{..{{,,,..,)).,)))}},,,||{(({{({|.,,},..})))}}).|(((((((|....},)))))))))))))..)))..))).)))))}......(((||,,,.|||...{{{...((((((((....({,.{((((((........))}}))}|,(,(({{{((({{,.......(((((((((....(((((({,(((.........{.{(((((((...((((.((.((((((((((((((((.,....})))))....))))...)))))).)).).)))...))))))))||{{......}}..))))))))))......(((((((((.....))))))))).......,,...,,)))))))))..,)))))))))})),......((((...)))),}}.....)))))))).)))..,..}}}}}||,,,..(((((((............))))))).}}})))))}}})}}}})}}}........,((((((....))))))|(((((((((.(((((((((.....))))))))).))).(..(((((.....)))))..))))))))|||{|,||||||||((((((,(.,(((({((({({,....{|{|,,..,,((((((((.((....((((((.({(((.(({{((((((..((((...(((.(((({..,((((.((.....((((.((((((...((((.((..((({.(((.(....((({...})))....).))).}.)))..)).)))))))))).)))).......)))))))))))))).)))).))))))))).)))).))))))....))))))))))|,..{{...(((((((((((((((...((((((((((.,|({,......|)),...))))).......))))}..))))))))))))))),,}}.,||{{,..}|},..,,},,,}}}))))|,|},,|,|}}||}.{{{((,,{{.,,,.,,.)})})))},)}))))))}}})).|||((({((((..(((((........)))))..))))..,,,.||||||}.....,,,||||||||{{{||{|||||||||,|||{{.{{{|,,,,))},.}}},,{{((((,(((,,...}}}.))}})),}})||,|}},.)})||||,|}}}}..}})}}}))))))))))),,.{{{(|,,..}}}}...,},.||||.......)))))))))))))}},)))))).......,.,,}..|,....},..}}|)}}))}.}.))).}}}.}}))....)))}..,,((({...|||||((({,,.........,}},},}))}))),.{(((((..(({...{(((.((((((.(((((((((((...)))..)))))...))).))))))))))))..)))))),||{{,|,{({{.,,,..,}}})}}.}))}.,........)))))).))),}.)))))).....))),...}))))..))))(((((((.((.....,,......||...((((({................(((((........))))).............,((((((((((((((.(({...{(((((,....((((...{.(((((,(((.{{{{,{{{(({{{,.{(((((......)))))}.{{{{({{{{{.,,,.))))))..)).))))}|}}}||(((((((..{{,,..((((((((........(({{{.{{{{{{{(((((,{{{{(,{{{{(((((({{{{,|}||||||..|||,},..},||||{,,.{||,{{|{,.,,((....))...)))).}}}...,)))),..||{.....}})|||,|||||.||,|||,(((((((........))))).)).})}...}).))))).))).....)))))))).,)}..))))))).,,...||,,.,}}||.(((((.(((((((,..............)))))))))))).}})|||,.,|||||,|.......,),},,.)))}}}))))).}...)))).))))))...,))).))))))))))))))))))))),.,.((((.((....)).)))).{(((((.....)))))}}).)))))))...

Transcripts

ID Sequence Length GC content
AUAACACCCGCGACCCCGCAGCUAAGCGCAGCUCCCGACGCAAUGGACC… 4887 nt 0.4909
Summary

Proteins containing a steroidogenic acute regulatory-related lipid transfer (START) domain are often involved in the trafficking of lipids and cholesterol between diverse intracellular membranes. This gene is a member of the StarD subfamily that encodes START-related lipid transfer proteins. The protein encoded by this gene is a cholesterol transporter and is also able to bind and transport other sterol-derived molecules related to the cholesterol/bile acid biosynthetic pathways such as 25-hydroxycholesterol. Its expression is upregulated during endoplasmic reticulum (ER) stress. The protein is thought to act as a cytosolic sterol transporter that moves cholesterol between intracellular membranes such as from the cytoplasm to the ER and from the ER to the Golgi apparatus. Alternative splicing of this gene produces multiple transcript variants. [provided by RefSeq, Jan 2016]

Forensic Context

A topographic transcriptomic analysis in mice identified STARD5 as one of five seed transcripts with highly specific enhanced expression in the nucleus accumbens shell [Crofton et al. DOI:10.1016/J.Neuropharm.2020.108398].