| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCGCAGCCGAGGGAACAAGCCCCAACCGGAUCCUGGACAGGCACCCCG… | 4871 nt | 0.4995 |
The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. This gene also plays a role in regulating host response to viral and bacterial infections. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. [provided by RefSeq, Aug 2020] CIViC Summary for STAT3 Gene
A study in rats demonstrated that severe hemorrhagic shock and resuscitation induced significant myocardial dysfunction and altered expression profiles, where the STAT3 mRNA was significantly up-regulated in heart tissue and validated via qRT-PCR [Lin et al. DOI:10.1186/s12867-018-0113-8]. A study in rats demonstrated that the STAT3 was significantly upregulated in liver tissue on day 7 following a 20% total body surface area burn injury, as part of a broader analysis of 740 significantly altered genes [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. In a separate study analyzing human and mouse burn tissue, weighted gene coexpression network analysis identified the STAT3 as a top 10 differentially expressed gene with upregulated expression in burn tissue [Guo et al. DOI:10.1155/2022/5220403].