| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCAUCUCUUGAAGCUUCACUUCAACUUCACUACUUCUGUAGUCUCAUC… | 649 nt | 0.3529 | |
| AUCAUCUCUUGAAGCUUCACUUCAACUUCACUACUUCUGUAGUCUCAUC… | 679 nt | 0.3520 |
Predicted to enable extracellular matrix constituent, lubricant activity and hydroxyapatite binding activity. Predicted to be a structural constituent of tooth enamel. Predicted to be involved in negative regulation of bone mineralization; ossification; and saliva secretion. Predicted to be located in extracellular region. [provided by Alliance of Genome Resources, Jul 2025]
A study in dogs demonstrated that the STATH mRNA was detected in 19 out of 20 canine saliva samples and in all five mock forensic samples of human skin bitten by a dog, showing no cross-reactivity with human samples and stability in stains stored at room temperature for 28 days [Nakanishi et al. DOI:10.1007/S00414-016-1391-7]. In humans, an RT-RPA-LFD assay using the STATH mRNA produced positive signals in 100% of saliva and nasal secretion samples, could detect as little as 100 fg of RNA, and successfully identified aged saliva samples stored for 180 days at room temperature [Liu et al. DOI:10.1016/j.fsigen.2022.102788]. A study in humans demonstrated that ELISA detection of the STATH is a specific and effective tool for the forensic identification of saliva, as it was specifically detected in saliva but not in blood, semen, vaginal fluid, sweat, or urine [Akutsu et al. DOI:10.1007/s00414-009-0391-2]. The assay successfully identified the STATH in aged saliva stains stored for years, in mixed body fluid stains containing saliva, and in various simulated casework samples such as cigarette butts and bottle lips, confirming its forensic applicability for confirming the presence of saliva where presumptive tests like those for α-amylase lack specificity.