| ID | Sequence | Length | GC content |
|---|---|---|---|
| UGCCUGCGCCUGAGCCUCUACGAGAGGGAAGGAACGCUGCUCCGAGCUC… | 2800 nt | 0.3811 | |
| UGCCUGCGCCUGAGCCUCUACGAGAGGGAAGGAACGCUGCUCCGAGCUC… | 2833 nt | 0.3812 |
This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016] CIViC Summary for BCL10 Gene
A study in human cadavers demonstrated that the BCL10 was significantly upregulated in a time-dependent manner in postmortem prostate tissues, showing elevated fold-changes at longer postmortem intervals (96 h and 120 h) compared to a 24-hour control [Tolbert et al. DOI:10.1016/j.gene.2018.06.090]. In contrast, an investigation of human cadaver liver tissues found the BCL10 was down-regulated (-10.2225 fold) in decaying samples compared to a control, indicating tissue-specific differential expression patterns in the apoptotic thanatotranscriptome [Javan et al. DOI:10.1007/S12024-015-9704-6].