Basic Information

Symbol
BCL10
RNA class
mRNA
Alias
BCL10 Immune Signaling Adaptor CIPER C-E10 ME10 CLAP CARMEN CED-3/ICH-1 Prodomain Homologous E10-Like Regulator Mammalian CARD-Containing Adapter Molecule E10 CARD-Containing Molecule Enhancing NF-Kappa-B Caspase-Recruiting Domain-Containing Protein CARD-Containing Apoptotic Signaling Protein CARD Containing Molecule Enhancing NF-KB CARD-Containing Proapoptotic Protein CARD-Like Apoptotic Protein B-Cell Lymphoma/Leukemia 10 Cellular Homolog Of VCARMEN B Cell CLL/Lymphoma 10 Cellular-E10 CCARMEN HCLAP BCL10, Immune Signaling Adaptor B-Cell CLL/Lymphoma 10 Bcl-10 IMD37
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_003921.5
Sequence length
2833.0 nt
GC content
0.3812

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-710.20 kcal/mol
Thermodynamic ensemble
Free energy: -762.73 kcal/mol
Frequency: 0.0000
Diversity: 634.63
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((...((((......((((((((((((.((((..((((.(((((((.(((((.((((......)))).)))...........)).)))))))))))))))..((((...(((......)))...))))....((.(((((((..(((........))).....))))))).)))))))).............((((((.((((...((((((.(((((((((((.((.(...(.(((((.(((..(((.(((.......))).)))..))).....))))).).).)).))))))).....(((.(((((((((..((((.(((((((((.((((((..(((((.(((((((((.((((((((.....)))))((((((.....(((((..(......)..)))))......))))))......((((..(((.....))).))))...((((((((........((((((((((((((((((((.(((.((((((...((....))((((......(((((((((....)))))))))........))))..)))))).....(((((((((((((((((((((((((((((((((...((((..((((...((((((((((......)).(((((((...............(((((.............)))))...((((((((((.((((((.........((((((..((((((.((...(((..((.....(((....))).....))))).)).)))))))))))).....)))))).)))))))))).((((((((((((((.((....((((((((.((..(((((((((((((.........(((.((((((.(..(((((...)))))..))).)))).)))..)))).)))).)))))....(((((.((((...((((.(.((..((((.....)))).))).)))))))))))))((((((....)))))).............((((((.(((.....(((((((.((((.......)))).)))))))..))).))))))(((((((((....(((((..........)))))))))))))).............))))))))))..........)).)))))))))))))).)))))))....((((.....))))..))))))))....))))..))))..))))))))...)))))))))))......((((((((((((..((......))..)))))))))))).((((.....)))).........((((((((((((...)))))))).))))))))))))......)))))))))))))))))))).))).)))))).....((((........((((.....))))(((((((.((((.((.......)).)))))))))))..)))).......(((((...........)))))..(((((.(((((...((((.((....)))))).....))))).)))))....))))))))(((((((((...(((((.(....((....))............((((((.......))))))........).)))))...)))))))))..((((......(((((.........))))).......)))).......))).)).))))))))))))..))))))......)))))))))))))..................))))...))))).)))....)))).))))))..(((((((((.........)).))))))).)))).))))))((((....))))..))))))..((((((...............))))))......((((.(.((......))).))))((((((((..(((.((((.((((((.(((((((.((((((((((..(((.((..(((((..........))))))).)))..)))))))))).(((((......)))))..(((((((.(((...........(((...(((((((((.((((...((((((..((((((......(((((.......))))).....))))))..))))))(((((((........)))))))......(((((.((((...((((((((((((....))))))..)))))).)))).))))).(((((((....)))))))..................)))).)))))))))))))))..))))))).......((((((..(((((((((((((((..(((...)))((((((.(((((((((................)))))))))(((((((((..........)))))))))(((((((((((....)))))))))))..............))))))..........(((((((((((.....((((((.(((......(((((((((....((((((..((((((..(((((((((((((((........)))))))....(((((((((((.(........(((((((....)))))))..).))))))))))).(((((...(((...)))..))))).)))))))).....)).)))).))))))......)))))))))....))).))).))).....)))))))))))((((....)))).))))))))...))))))).)))))).))))))))))))))))).)))..))))))))..((((((..((((..(((.....))).))))..))))))......(((((......)))))..((((.((((......)))).)))).......))))))))....
Thermodynamic Ensemble Prediction
....,({(,..((((((((((((((((((((((.,((,{{((((.(((((((.(((((.((((......)))).)))...........)).))))))))))}})))}.{(((...(((....,.)))...)))}....{,.(((((((..(((........)))}})}}))}}}})}).}}}))))),,,........((((((.((((...((((((.(((((((((((.((.{...(.(((((.(((..(((.(((.......))).)))..))).....))))),,.,.)).))))))).....(((.(((((((((..((((.(((((((((.((((((..((({((((((((({{.((((((((.....)))))((((((,....(((((..(......)..)))))....,.)))))).,....((((..(((,...,))).))))...((((((((.,......((((((((((((((((((((.(((.((((({...{,....|}((((,.....(((((((({....}))))))))........)))}.,))))))....{((((((,,,,{(,((((((((((((((((((((...((((..((((...(((((((({(....,.|,.(((((((.,......,||,,..{|(({.............))))}...((((((((((.((((({.........((((((..((((((.((...(((..((.....(((....))).....}}))).)).))))))))))))....,)))))).)))))))))).((((((((((((((.((....((((((((.((.,(((((((((((((....,....(((.((((((.,..(((((...}))))..})).)))).)))..)))).))))}}))))}...{((((.((((..,{((((,.{...{{{,.....,)}})))).}}..))))))))}((((((....}))))).............{(((({.(((.....{((((((,((({......,)))).))))))}..})).)))))}(((((((((....(((((..........)))))))))))))).............))))))))))..,,......)).)))))))))))))).}}}}})}....((((.....)))),.))))))))....)))).,))),..))))))))...)))))))))))}.,,..,,|||||||,,,,,(({,....})}})},||||,,|||.((((.....))))}))..}}}}{(((((((((({...}))))))).)))||},,,)))},.,,.,}}})))))))))))))))).))).)))))).....((((........((((.....))))((((((,{((((.((.......)).)))))))))))..)))).......{{,,,...........}}}}},.(((((.(((((...((((.((....)))))).....))))).))))),...))))))))(((((((((...(((((.(....(((,,....,,,........{{{{{{.......}}}}}}.,,.....,.)))))...)))))))))..((((......(((((.........))))).......)))).......))).)},})))))))))))..))))))......)))))))))))))..................))))...))))).)))....)))).)))))).,(((((((((.{.......)).))))))).)))).))))))...({{...((((.....)))),{,|||.{{{{..{{......))))))}.,,,,((((.(.((......))).)))}.,,.,,||,,....|||}))))))..((((({,.((((((((((..(((,(((,(({({......}},,)))))},.}))..)))))))))).(((((......)))))..,{||||||{{{....|||,.,.....,|((,,((((({((({{,.((((((..((((((..,...(((((.......)))))..,,.))))))..))))))..,,..{(({({{,.{|||||}{|.|||{{{{,,(((({{,((((,(({{{{(,,,,|,||||{,,}}}|).)|||,|}|||.(((((((....)))))))...}.},}}}}}}}}.}}})}}.,,,,,,,,,{{.{{{{{{||||||.....,,{{{{,.,.((((((((,((((,,..(,{{..||.{((,,,..((((((((..,{........,,..)))))))))||,||,,||,....,}}}}))))))},,|||||||||||}}}.)),},|||((|..,||},,,,,,,..,.)))},,.,.,,,.(((((((((((...,,((((((.(((.,....(((((((((....((((((..{{((((..(((((((((((((((........))))))).,,.(((((((((((.,........(((((((....))))))).,},)))))))))))}|{{{{.,.{{{...}}),.}}})}.))))))))...,.))},))).))))))......)))))))))....))).))).))}.,,..)))))))))))||,|},,,})))})))))),)}.}}}}}}.},})))))),},)},}))))))))))})..}})),}}}||,.{(((((.,((({..,,,.....}}}.)})),,)}}}}}.,||,.(((((......)))))..|{{{.((((......)))).)})}.......)))),))}....

Transcripts

ID Sequence Length GC content
UGCCUGCGCCUGAGCCUCUACGAGAGGGAAGGAACGCUGCUCCGAGCUC… 2800 nt 0.3811
UGCCUGCGCCUGAGCCUCUACGAGAGGGAAGGAACGCUGCUCCGAGCUC… 2833 nt 0.3812
Summary

This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016] CIViC Summary for BCL10 Gene

Forensic Context

A study in human cadavers demonstrated that the BCL10 was significantly upregulated in a time-dependent manner in postmortem prostate tissues, showing elevated fold-changes at longer postmortem intervals (96 h and 120 h) compared to a 24-hour control [Tolbert et al. DOI:10.1016/j.gene.2018.06.090]. In contrast, an investigation of human cadaver liver tissues found the BCL10 was down-regulated (-10.2225 fold) in decaying samples compared to a control, indicating tissue-specific differential expression patterns in the apoptotic thanatotranscriptome [Javan et al. DOI:10.1007/S12024-015-9704-6].