Basic Information

Symbol
STC1
RNA class
mRNA
Alias
Stanniocalcin 1 STC Stanniocalcin-1 STC-1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_003155.3
Sequence length
3868.0 nt
GC content
0.4369

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1072.5 kcal/mol
Thermodynamic ensemble
Free energy: -1142.68 kcal/mol
Frequency: 0.0000
Diversity: 866.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((....))))((.((((((((((((..(((((((((((.((.((.((.((.((.((.((.((.((....)).)).)).)).)).)).)).)).)).))((.(((((((((((..((....)).)))))....................................(((...........)))......((((((((((((((..(((((..((((((((.....((..(((((((((((..((((..........(((...(((.((((........(((....)))......(((.(((((((...))))))).)))....(((....)))......((((((((((((((((......(((((((((((.....))...))).))))))....((((((...((((((((((((.((..(((((((.((((((..((.((((((.....(((((.((((((....)))).((((...))))..)).))))).....))))))...))..)))))).))))))).............((((((..((((.(((......))).))))................((((.((((((((((((.......))).)).)))))))))))....(((...)))...((((((.(((((.......))))).))))))((((........))))..(((...)))...))))))..........(((((.(.(((...(((((((...(((((((.(((..............((((((......((((((..((((.......)))).))))))......).))))).))).))))))).)))))))......))).).))))).......(((((..(((((..(..((((......)))).....)..)))...))..))))))).)))...)))))))))...)))))).((((((((((((((...)))....))))))))))).....((((.........((((.((......)))))).......))))((((((......))))))....................((((((((((.((((((....)).)))).....(((((((((((((((((((((((((...)))))))............))))))))).....)))))))))........))))))))))..)))))))).((((..((((.................))))..))))))))))))......((.(((((......))))).))...)))).)))...)))))))..)))))))))))....))....)).........(((....)))..)))))).))..))).....))))))))))))))..........)).))))))(((((((((..((....))..)))))))))....)))).)))......((((((.((((..((((((((((((((((((.((..((((((.....))))))))))))))))).)).)))))))..))))........))))))..(((((....((....(((........))).......))....)))))............(((((((.((((........)))).).))))))..))..))))))))))))..))........((((((((((.(((((.(((((......(((...)))......))))).........((((((((..(((((((........((((...((.((((((.((.((((...............))))...)).)))))).))))))((((((.....))))))..........(((((((((((((.(((((((...(((((.(((((...............((((((.((((.......)).)).))))))....(((((...........)))))................(((((.((((((((........((((((.........((((((((((((.((.............))))))))))))))...((((((((((...........((((.((((((.((((......))))...((((.((((.(((((((..((((((((...(((((((.(((..(((((...))))).....................(((((((...(((((...)))).)...)))))))..........))).))))))).))))).((((.((((..((((((.((((.........))))..)))))).)))))))).((((((((.............)))..)))))...)))....)))))))..)))).))))......)))))).))))...........))))))..))))((((............(((((((.....((((.((((....))))((((((.........))))))..))))......)))))))............(((((((((((((((((((((((((((((((((((.......((((((((...........(((((..((....))..))))))))))))).((((....)))).....((((((((((....(((((..(((((((..(((((...((....))))))))))...))))....)))))((......))............(((((((((((((((((((((.((((.....((((((........(.((((((((.......(((((((.(((..((((((((((((((.((((..(((((....)))))))))..)))....)))))))))))..)))(((((.......((......)).((((........))))........)))))....)))))))..(.((((.....((((.(((.((..((((.((.......)).))))..)).((((((.......))))))))).)))).....))))))))))))).).(((((......))))).(((((.((((......)))).)))))........))))))......(((((...((((((...((....)).....)))))).))))).((((...)))).))))))))).)))))((..(((.((.......)).)))..)).(((.((((...)))).)))........(((((((...((....))...)))))))........((.((((.....(((.(((.....))))))......)))).))......)))))))))))..))))).)))))))))))))))).)))))))))))))))))))))))).))))((((.((((((....(((((.................))))).........((((((((((.....))))))))))...............)))).))...)))).))))))........))))))))....)))))..(((((((...((((..(((((....((((....(((..............)))...)))).....)))))..((((((((((((.(((((.((......)).))))).))))))((((.............)))).((((((..((((...))))..))))))............)))))).))))..)))))..))((((((.(((((.(((((.....)))))))))).))))))))))).)))))...))))).)).))))))).))))))(((((....(((...)))...)))))....((((((......)))))).((((((((....)))))))).((((......))))....)))))))..........)))))))).........)))))))))).))))).
Thermodynamic Ensemble Prediction
.{{((,,..,,)}{{.((((((((((((,.((,.((((.((.((.((.((.((.((.((.{{.{{.||.}}.)).)).)).)).)).)).)).)}.)}.)}((,(({{{{(((((,.((....}}.}}}}}.{,.................................,,,,...|{,,...|||,.....((((((((((((((..(((({..((((((((...,.({..(((((((((((..(((,..........,{{...{{(.((({.......,(((...,||,......(((.(((((((...))))))).)))...|{((,.,.)),.....,(((({(({((((((((......(((((((((((.....)}...))).))))))....((((((...(((((((((((........(((((((.(((((((((({{((((,...{{{{,,{,((((....)))}.((((..,|}||,,||{{{|||,..,.,}})}}.,,}},,}})}))}))|||||{.....,{{{...|||||{..((((.(((......))).)))).....||,.,,,....((((.((((((((((((.......))).)).)))))))))))..,,||,..,|||||.,{(({{.{{{||,(((((((.(({.,,||,.((((........))))..,((,,,|||{{.,|||},,{......,,,|||{.,}||,}}}(((((((...(((((((.(((..........,,..{(((((......((((((..((((.......)))).))))))...,..).))))).))).))))))).)))))))......)))},}))))))))).}}}}}||}}|||||....,|||{......}}}}}}).}}})))))))).....)}))).)))))))))))))))...)))))).(((((((((((,,..{{|,,.,}})))))))))))....,({{{.........((((.((......)))))).......))))((((((......))))))....................((((((((((.((((((....}).)))}{{.,.((((((((({(((((((({((((((...,}}}}},,,.......,,.)))))))}}...,.)))))))))....}}..))))))))))..}}}}}}}}.,{((,,{{{{.................}))),.}))))))))))),||,,.||}||{{|,.....))}},.,....}}}),)))...}))))))..)))))))))))....}}...})}.........{{,....)))..}))))).)}..))).....))))))))))))))..........}),}))}}}{((((((((..((....))..))))))))}....,{{{{,,,....}}||{{{,.((((..((((((((((((((((((.{{..((((((.....))))))}}))))))))).)).)))))))..)))).,.,.,..,})))}..{{|{{...,{{..,,{|,....,...|||.......,.....))))}............((({(((.((((........)))).)))})))).}))..))))))))))))..}}........((((((((((.(((((.(((((.,.,..(({...}))......))))}.........((((((((..(((((((...,,,..((((...((.((((((.{,.,(((.......,...,||,}}})..,),.)))))).))))))((((((.....))))))......{{,,(((((((((((((.(((((((...(((((.(((((...............((((((.((({.......)},)).))))))....(((((...........)))))...............,(((((,((({((((........{{{{{{.....|{,.((((((((((((.{(............,}})))))))))))),|||{,.((((((.....,..,..((((.((((((.((((......))))...((((.((((.(((((((..((((((((...(((((((.(((..(((((...))))).....................(((((((...,((({...}))).)...)))))))..........))).))))))).)))),.((((.((((..((((((.((((.{,....).))))..)))))).)))))))).((((((((.............)))..}))))..,)))....)))))))..)))).))))......)))))).))))..,........))))))..((((((((......,.....{{{{{{{...,,((((,({{(,,.((((((,{{,......,....)))))).))}}.....,))))))).,,.........{((((((((((((((((((((((((((((((((((,......((((((({.,,.....,,.(((((..((....))..))))))))))))).((((....)))).....{(((((((((..,,((,({,,(({((((..(((((...{{....}}))))))))}..,))),...)))),{{......)),........,{{((((((((({(((((((((((.((((.,...((((((........{.((((((((.......({(((((.(((,.((((((((((((((.((((..(((((....)))))))))..)))....)))))))))))..|||{({{{...}},,|,......||.{{{{........}}}}....,...)}}},....}}}}}}}..,,{{({.,,..{{||,|{{.((..,(((.((.......)).)))),.||,(((({{......,))))))}}},|}}}.....)))},}))))))).).(((((......))))).(((((.((((......)))).)))))........)))))),.,,,,(((((...((((((...((....)).....)))))).))))).,,{|,},)}),.)))})))))})}))))...{{{,{,.......}}.}}},{||,{{{,((((,..)))}.,||{{.....,|{{(((({{{((.{{,|....,||,,,,........|{.{|||,..},|||}{||,,,..))))}},,}...}))).))......})))))))))},.))))),))))))))))))))))))))))))))))))))))))))))}.))))).))).,||||,...(((((.................))))).||......((((((((((.....))))))))))..........,|,.{((({,{|.,||..|.,}}}))..,}....))))))))....)}))}..{|{((((...((({..(((((....((((....(((..............)))...)))).....)))))..((((((((((((.(((((.((......)).))))).)))))}((((.............)))).{(((((..((((...})))..))))))...........,)))))}.}}))..))))).,)){(((((.{((({,(((((.....)))))))))).))))))))))).)))))...))))).)).))))))).))))))|||||,...,...{{{{,...}}}},....((((((......)))))).{(((((((....)))))))}.{{{{.,....)))),,}.))))))){{.....,,,)))))))}.........)))))))))).))))).

Transcripts

ID Sequence Length GC content
AGUUUGCAAAAGCCAGAGGUGCAAGAAGCAGCGACUGCAGCAGCAGCAG… 3868 nt 0.4369
Summary

This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the STC1 mRNA is a useful marker for menstrual fluid identification, being more consistently detectable than MMPs over the days of menstruation and most useful for identifying late menstrual samples, with its abundance appearing unaffected by hormonal contraceptives [Albani et al. DOI:10.1016/J.Fsigen.2020.102359]. In a subsequent methodological study, two RT-LAMP assays and two guide RNAs were designed for the STC1 to develop a confirmatory detection assay for body fluids using RT-LAMP-CRISPR, though amplification was inconsistent during temperature optimization [Lynch et al. DOI:10.1016/j.fsigen.2024.103167].