| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCGCGGCGCUGCUAACGGCCUGGUCACAUGCUCUCCGGAGAGCUACG… | 4254 nt | 0.5014 |
This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]
A study in human and Sprague-Dawley rat brain tissue demonstrated that the STC2 mRNA and protein levels were significantly down-regulated in death from mechanical asphyxia (DMA) compared to control groups like craniocerebral injury and hemorrhagic shock, regardless of postmortem interval, age, or temperature [Hu et al. DOI:10.1016/J.Legalmed.2023.102382]. Another study in mice investigating asphyxia due to oxygen deficiency mentioned the STC2 as a protein marker for the postmortem diagnosis of asphyxia [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].