| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCGCCGCGUGGGGCCCGCACCUCUGGGCAGCAGCGGCAGCCGAGACU… | 1219 nt | 0.3995 |
This gene is predominantly expressed in prostate tissue, and is found to be upregulated in multiple cancer cell lines. The gene product is predicted to be a six-transmembrane protein, and was shown to be a cell surface antigen significantly expressed at cell-cell junctions. [provided by RefSeq, Jul 2008]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that exposure to arsenic trioxide (As2O3) significantly suppressed the STEAP1 by -6.1-fold according to microarray analysis, with a decreasing tendency observed via qRT-PCR [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774].