| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUCCGAGCGCCGCGCUGGGGAGAGCGGGUGUUUGAAGGCUCCGCGG… | 3918 nt | 0.3925 |
This gene is a member of the DAP kinase-related apoptosis-inducing protein kinase family and encodes an autophosphorylated nuclear protein with a protein kinase domain. The protein has apoptosis-inducing activity. [provided by RefSeq, Jul 2008]
A study in human skin demonstrated that the STK17A is significantly up-regulated in thermally injured tissue during the early wound repair process [Greco et al. DOI:10.1016/j.burns.2009.06.211]. In rhesus macaques, transcriptomic analysis identified the STK17A as a differentially expressed gene that is upregulated in animals with hypertrophic cardiomyopathy [Rivas et al. DOI:10.1038/s41598-024-82770-4].