| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAACCGCGACUGCAAGCUUCGGUAGUCCUCUCCGCUGCUGUCGCCAGGA… | 5273 nt | 0.3672 |
Enables ATP binding activity and protein serine/threonine kinase activity. Involved in intracellular signal transduction; positive regulation of fibroblast apoptotic process; and protein phosphorylation. Located in Flemming body and nucleoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in mouse cardiac mesenchymal stem cells demonstrated that overexpression of the STK17B activated cell cycle pathways and promoted proliferation, with RNA-seq identifying STK17B (DRAK2) as an upregulated hub gene in this transcriptional reprogramming [Zhang et al. DOI:10.3390/biom15050662].