| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUCCUCCGCCUCCUGGUGUGGCUGGCUGCGGCCAGAAUCGGAGCCC… | 5646 nt | 0.4061 | |
| CUCUUCCUCCGCCUCCUGGUGUGGCUGGCUGCGGCCAGAAUCGGAGCCC… | 5529 nt | 0.4003 |
Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
A study in mice demonstrated that the STON1 was specifically up-regulated in liver tissue following Kupffer cell-specific exposure to α-particle radiation, as identified through oligonucleotide microarray analysis of 6,050 genes [Roudkenar et al. DOI:10.1269/jrr.07078].