| ID | Sequence | Length | GC content |
|---|---|---|---|
| CAAAAGAAAGAGGUAAGCGUGGCCUGACCUAGCCACCCACCAACAGGAA… | 783 nt | 0.3525 |
Predicted to enable enzyme activator activity. Predicted to be involved in regulation of calcium ion transport and regulation of striated muscle contraction. Predicted to act upstream of or within positive regulation of ATPase-coupled calcium transmembrane transporter activity and positive regulation of calcium ion import. Predicted to be located in sarcoplasmic reticulum membrane. [provided by Alliance of Genome Resources, Apr 2025]
A review of long noncoding RNAs in cardiovascular diseases noted that in Drosophila, the micropeptide DWORF, derived from a long noncoding RNA, enhances cardiac contractility by decreasing the time of individual contraction-relaxation cycles through interference with SERCA inhibitors like phospholamban [Chih-Fan Yeh et al. DOI:10.1186/s12929-020-00647-w].